scholarly journals First Report of Tomato ringspot virus Infecting Pepper in Iran

Plant Disease ◽  
2012 ◽  
Vol 96 (12) ◽  
pp. 1828-1828 ◽  
Author(s):  
Y. Sokhansanj ◽  
F. Rakhshandehroo ◽  
R. Pourrahim
Keyword(s):  
Mosaic Virus ◽  
Ringspot Virus ◽  
Local Lesion ◽  
Capsicum Frutescens ◽  
Polymerase Gene ◽  
Rt Pcr ◽  
Viral Polymerase ◽  
First Report ◽  
Tomato Ringspot Virus ◽  
Das Elisa

Chili pepper (Capsicum frutescens) represents an important crop in Iran and is under cultivation in different regions in Northern Iran. In spring 2012, commercially grown tabasco (Capsicum frutescens) peppers in Varamin, Shahriar, and Karaj districts of Tehran province developed an undescribed disease. Symptoms observed were mosaic, leaf malformations, and stunting. Fruit symptoms included chlorosis and distortion. To verify the identity of the disease, six fields were surveyed and 72 symptomatic leaves were collected and screened by double antibody sandwich (DAS)-ELISA using specific antibodies to Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), Pepper mild mottle virus (PMMV), Tomato mosaic virus (ToMV), Tobacco mosaic virus (TMV), and Arabis mosaic virus (ArMV). ToRSV was found in 23% of the samples collected. None of the samples had a positive reaction to other tested viruses. The ToRSV-positive peppers were used for mechanical transmission to Chenopodium quinoa, local lesion host, and after two cycles of single local lesion isolation, they were transferred to Cucumis sativus, Solanum esculentum, and Capsicum fructescens. Inoculations resulted in systemic mosaic and chlorotic local lesion on C. sativus; leaf distortion and mosaic on S. esculentum; and mosaic, mottle, and stunting on C. fructescens. All inoculated plants were positive for ToRSV with DAS-ELISA. To further verify ToRSV infection, reverse transcription (RT)-PCR was conducted. Two primers were designed on the basis of the highly conserved sequences of the putative viral polymerase gene available in the GenBank. RT-PCR of total RNA extract from infected peppers and inoculated plants with the designed primers RdR-R (5′-CGCCTGGTAATTGAGTAGCCC-3′) and RdR-F (5′-GAAGAGCTAGAGCCTCAACCAGG-3′), consistently amplified the 411-bp product, while no amplification products were obtained from noninfected control (healthy plants). The fragment from tabasco pepper was cloned into pTZ57R/T (Ins T/A clone PCR Cloning kit, Fermentas, St. Leon-Rot, Germany) and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. JQ972695) had the highest identity (94%) with the polymerase gene of a ToRSV isolate from blueberry cv. Patriot (Accession No. GQ141528) and had lower identity (91%) with that of a ToRSV isolate from blueberry cv. Bluecrop (Accession No. GQ141525). Tomato ringspot virus (ToRSV) is reported to infect Capsicum spp. in the United States (1,2). Our results confirm the natural infection of pepper plants in Tehran by ToRSV. To our knowledge, this is the first report of ToRSV infection of pepper in Iran. The finding of this disease in Tehran confirms further spread of the virus within northern regions of Iran and prompts the need for research to develop more effective management options to reduce the impact of ToRSV on pepper crops. Beside, primers designed on the basis of putative viral polymerase gene sequences may improve the detection of ToRSV isolates by RT-PCR in Iran. References: (1) S. K. Green and J. S. Kim. Technical Bulletin. No.18, 1991. (2) G. P. Martelli and A. Quacquarelli. Acta Hortic. 127:39, 1983.

scholarly journals First Report of Tomato ringspot virus in Butterfly Bush (Buddleia davidii)

Plant Disease ◽  
2003 ◽  
Vol 87 (1) ◽  
pp. 102-102 ◽  
Author(s):  
P. L. Hughes ◽  
S. W. Scott
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
Southeastern United States ◽  
Positive Control ◽  
Ringspot Virus ◽  
Home Garden ◽  
Line Pattern ◽  
Rt Pcr ◽  
First Report ◽  
Tomato Ringspot Virus

Leaves displaying bright yellow or light green line pattern symptoms were collected from individual, large, mature buddleias in a home garden in Clemson, SC, a botanical garden in Knoxville, TN, and a container-grown plant on sale in a retail home and garden store in Seneca, SC. Buddleias grown in the southeastern United States frequently display virus-like symptoms, but the line pattern symptom displayed by these plants was atypical of the mosaic, mottling, and leaf deformation seen when buddleias are infected with Alfalfa mosaic virus (AMV) or Cucumber mosaic virus (CMV) (2,4). Line pattern symptoms are frequently seen in woody species infected by ilarviruses or nepoviruses (2). No ilarviruses are reported to infect buddleia and only the nepovirus, Strawberry latent ringspot virus, which is restricted mainly to Europe, is reported to infect this species (1,2). The nepoviruses Tomato ringspot virus (ToRSV) and Tobacco ringspot virus (TRSV) are frequently found infecting plants of many species in the southeastern United States (3). Total RNA was extracted from the three symptomatic plants and used in reverse transcription-polymerase chain reactions (RT-PCR) to detect ToRSV and TRSV using primer pairs developed in this laboratory, which amplify regions around the amino terminus of the coat protein of the respective viruses. The expected amplification product for ToRSV of 327 base pairs was obtained from samples tested from each plant, and the nucleotide sequence of the product showed 96% identity with the corresponding fragment of GenBank Accession No. NC_003839 that the primers were designed to amplify. Repeated attempts to isolate a virus from symptomatic leaves using sap inoculation to Chenopodium amaranticolor Coste & Reyne, C. quinoa Willd, Nicotiana clevelandii Gray, and N. tabacum L. have failed. Repeated testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) of leaves from the plant growing in Clemson consistently produced absorbance values at 405 nm in the range of 0.47 to 0.55 (mean of 8 separate samples per test) for symptomatic and asymptomatic leaves. The range of values for the positive control (ToRSV-G growing in N. clevelandii) was 1.3 to 1.5. The ranges of values for the noninfected controls (noninfected N. clevelandii and leaf tissue from a buddleia known to be infected with AMV and CMV but in which ToRSV or TRSV had never been detected by RT-PCR) were 0.102 to 0.104 and 0.102 to 0.106, respectively. The extraction buffer produced absorbance readings in the range of 0.098 to 0.102. RT-PCR of RNA extracted from other portions of the leaves used in the ELISA consistently amplified the 327-bp product from symptomatic leaves and from the positive control but not from noninfected control tissues. RNA from asymptomatic leaves on the infected plant also produced the 327-bp product in RT-PCR. Isolation of viruses from woody hosts is frequently difficult, and although, we have yet to succeed to confirm the association between the observed symptom and ToRSV, the evidence from PCR and ELISA would indicate ToRSV is present in these plants. To our knowledge, this is the first report of ToRSV, a member of the genus Nepovirus, in buddleia. References: (1) J. Albouy and J. C. Devergne. Maladies á Virus des Plants Ornementales. INRA Editions, Paris, 1998. (2) J. I. Cooper. Virus Diseases of Trees and Shrubs. 2nd ed. Chapman and Hill, London, 1993. (3) J. R. Edwards and R. G. Christie. Pages 352–353 in: Handbook of Viruses Infecting Legumes. CRC Press, Boca Raton, FL, 1991. (4) C. J. Perkins and R. G. T. Hicks. Plant Pathol. 38:443, 1989.

scholarly journals First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽  
2013 ◽  
Vol 97 (4) ◽  
pp. 561-561 ◽  
Author(s):  
S. Khankhum ◽  
P. Bollich ◽  
R. A. Valverde
Keyword(s):  
Common Bean ◽  
Mosaic Virus ◽  
Seed Quality ◽  
Soybean Mosaic Virus ◽  
Ringspot Virus ◽  
Wild Plants ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
First Report ◽  
Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

A Survey for Nine Major Viruses of Grapevines in Tennessee Vineyards

2020 ◽  
Vol 21 (3) ◽  
pp. 157-161
Author(s):  
Nourolah Soltani ◽  
Rongbin Hu ◽  
Darrell D. Hensley ◽  
David L. Lockwood ◽  
Keith. L. Perry ◽  
...  
Keyword(s):  
First Record ◽  
Ringspot Virus ◽  
Rt Pcr ◽  
Grapevine Fanleaf Virus ◽  
Arabis Mosaic Virus ◽  
Growing Seasons ◽  
Tomato Ringspot Virus ◽  
The Status ◽  
Diagnostic Approaches ◽  
Das Elisa

Despite the significance of grape production to the fruit industry in Tennessee (TN), no published information has been available on viruses affecting grapevines in the state. Hence, a survey was conducted during the 2016 and 2017 growing seasons to determine the status of nine major viruses of grapevines in TN vineyards by taking advantage of classical serological assays and confirmatory nucleic acid-based diagnostic approaches. A total of 349 samples from 23 grapevine cultivars mostly displaying viral-like symptoms were collected from 23 commercial vineyards. All samples were assayed by DAS-ELISA for arabis mosaic virus (ArMV), grapevine leafroll-associated virus (GLRaV)-1, GLRaV-2, GLRaV-3, GLRaV-4, grapevine fanleaf virus (GFLV), tobacco ringspot virus (TRSV), and tomato ringspot virus (ToRSV). Selected serologically positive samples were also tested by RT-PCR, followed by Sanger sequencing of the generated amplicons. Additionally, 19 grapevines displaying symptoms characteristic of grapevine red blotch virus (GRBV) were also assayed by PCR followed by confirmatory sequencing-based methods. Collectively, these assays verifiably detected GLRaV-1, GLRaV-2, GLRaV-3, ToRSV, and GRBV in TN vineyards. This is the first record of the presence of these viruses in TN vineyards. ArMV, GLRaV-4, GFLV, and TRSV were not detected. The majority of samples tested positive for a single virus, whereas mixed infections with more than one virus were detected in 37% of samples.

scholarly journals Occurrence of Stone Fruit Viruses in Plum Orchards in Latvia

2013 ◽  
Vol 67 (2) ◽  
pp. 116-123
Author(s):  
Alina Gospodaryk ◽  
Inga Moročko-Bičevska ◽  
Neda Pūpola ◽  
Anna Kāle
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
Ringspot Virus ◽  
Stone Fruit ◽  
Detection Methods ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
Detection Rates ◽  
Arabis Mosaic Virus ◽  
Das Elisa

To evaluate the occurrence of nine viruses infecting Prunus a large-scale survey and sampling in Latvian plum orchards was carried out. Occurrence of Apple mosaic virus (ApMV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Apple chlorotic leaf spot virus (ACLSV), and Plum pox virus (PPV) was investigated by RT-PCR and DAS ELISA detection methods. The detection rates of both methods were compared. Screening of occurrence of Strawberry latent ringspot virus (SLRSV), Arabis mosaic virus (ArMV), Tomato ringspot virus (ToRSV) and Petunia asteroid mosaic virus (PeAMV) was performed by DAS-ELISA. In total, 38% of the tested trees by RT-PCR were infected at least with one of the analysed viruses. Among those 30.7% were infected with PNRSV and 16.4% with PDV, while ApMV, ACLSV and PPV were detected in few samples. The most widespread mixed infection was the combination of PDV+PNRSV. Observed symptoms characteristic for PPV were confirmed with RT-PCR and D strain was detected. Comparative analyses showed that detection rates by RT-PCR and DAS ELISA in plums depended on the particular virus tested. The results obtained in this study revealed that commonly grown plum cultivars in Latvia are infected with economically important stone fruit viruses and highlight the need to implement a programme to produce and propagate virus-free planting material.

scholarly journals First Report of Papaya ringspot virus and Zucchini yellow mosaic virus in Luohanguo (Siraitia grosvenorii) in China

Plant Disease ◽  
2005 ◽  
Vol 89 (5) ◽  
pp. 530-530 ◽  
Author(s):  
Y.-M. Liao ◽  
X.-J. Gan ◽  
B. Chen ◽  
J.-H. Cai
Keyword(s):  
Mosaic Virus ◽  
Zucchini Yellow Mosaic Virus ◽  
Viral Disease ◽  
Ringspot Virus ◽  
Yellow Mosaic Virus ◽  
Watermelon Mosaic Virus ◽  
Papaya Ringspot Virus ◽  
Rt Pcr ◽  
First Report ◽  
Siraitia Grosvenorii

Luohanguo, Siraitia grosvenorii (Swingle) C. Jeffrey, is a perennial cucurbitaceous plant that is an economically important medicinal and sweetener crop in Guangxi province, China. Surveys conducted during the summer to fall seasons of 2003-2004 in northern Guangxi showed symptoms typical of a viral disease, including leaf mottling, mosaic, vein clearing, curling, and shoestring-like distortion in the field. Mechanical inoculation of sap from leaves of symptomatic plants collected from the surveyed areas caused similar symptoms on tissue culture-derived healthy Luohanguo plants. Two sequences of 0.7 and 1.6 kb with 88 and 97% identity to Papaya ringspot virus (PRSV) and Zucchini yellow mosaic virus (ZYMV) were amplified using reverse transcription-polymerase chain reaction (RT-PCR) with purified flexuous viral particles or total RNA extracted from the symptomatic Luohanguo leaves as templates with conserved degenerate potyvirus primers (1). To confirm the results, primers specific for PRSV (PP1/PP2, genome coordinates 4064-4083/5087-5069, GenBank Accession No X97251) and ZYMV (ZP1/ZP2, genome coordinates 5540-5557/7937-7920, GenBank Accession No L31350) were used to perform RT-PCR from the same RNA templates. The expected 1.0- and 2.3-kb fragments were amplified and they were 90 and 95% identical to PRSV and ZYMV in sequence, respectively. Watermelon mosaic virus was not detected. To our knowledge, this is the first report of the occurrence of PRSV and ZYMV in Luohanguo. Reference: (1) A. Gibbs et al. J. Virol. Methods 63:9, 1997.

scholarly journals First Report of Moroccan watermelon mosaic virus in Zucchini Crops in Greece

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 702-702 ◽  
Author(s):  
I. Malandraki ◽  
N. Vassilakos ◽  
C. Xanthis ◽  
G. Kontosfiris ◽  
N. I. Katis ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Sub Saharan Africa ◽  
Yellow Mosaic Virus ◽  
F1 Hybrids ◽  
Watermelon Mosaic Virus ◽  
Common Source ◽  
Rt Pcr ◽  
F1 Hybrid ◽  
First Report ◽  
Das Elisa

In the summer of 2012, zucchini (Cucurbita pepo L.) plants of F1 hybrid Rigas showing very severe malformation and blisters in leaves and fruit were observed in the prefectures of Ilia and Messinia, Peloponnese, southwestern Greece. Over 100 samples were collected and only a few were found by double antibody sandwich (DAS)-ELISA to be singly or mixed infected with the commonly encountered Cucumber mosaic virus (CMV, genus Cucumovirus), Zucchini yellow mosaic virus (ZYMV, genus Potyvirus), and Watermelon mosaic virus (WMV, genus Potyvirus), to which Rigas is known to be tolerant. All affected plants were also tested by DAS-ELISA and RT-PCR (2) for the presence of Moroccan watermelon mosaic virus (MWMV; genus Potyvirus), a virus not previously reported in Greece, and were consistently found positive by both methods. Sap from plants in which MWMV was solely detected was used to mechanically inoculate Chenopodium quinoa Willd. and cucurbit species (zucchini, cucumber, melon, and watermelon). C. quinoa produced chlorotic local lesions, while cucurbits showed very severe mosaic and malformation of leaves. Zucchini plants of F1 hybrids Rigas, Golden (tolerant to WMV and ZYMV), and Elion (not exhibiting any tolerance) grown in a screenhouse produced equivalent severe symptoms on leaves and fruits. Furthermore, transmission experiments in a non-persistent manner using a clone of Myzus persicae Sulz. and zucchini plants of F1 hybrid Boreas as donor and test plants were carried out. Ten plants were used in each experiment (one aphid/plant) and this was repeated five times (50 plants in total). The transmission rate was high ranging from 75 to 90%. RT-PCR obtained amplicons of 627 bp were subjected to direct sequencing (GenBank Accession No KF772944), which revealed 99% sequence identity to the corresponding region of a MWMV Tunisian isolate (EF579955). In 2013, in addition to zucchini plants found MWMV positive, watermelon (Citrullus lanatus Thunb.) plants from the same region of Peloponnese showing leaf malformation and mosaic symptoms were found MWMV positive (4/30) by DAS-ELISA and RT-PCR, revealing the virus establishment and further spread. In the Mediterranean basin, the virus has already been reported in Morocco, Italy, France, Spain, Tunisia, and Algeria, where it has emerged recently from a common source, has quickly become established through rapid dissemination and is considered as an important emerging threat (4). Isolates from these countries, including the present one from Greece, are very closely molecularly related to each other, contrary to isolates from sub-Saharan Africa (South Africa, Sudan, Congo, Zimbabwe, Niger, Cameroon, Nigeria) that are much more divergent (1,3). To our knowledge, this is the first report of MWMV in Greece. References: (1) H. Lecoq et al. Plant Dis. 85:547, 2001. (2) H. Lecoq et al. New Dis. Rep. 16:19, 2007. (3) A. T. Owolabi et al. Int. J. Virol. 8:258, 2012. (4) S. Yakoubi et al. Arch. Virol. 153:775, 2008.

scholarly journals First Report of Soybean mosaic virus on Soybean in North Dakota

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 760-760 ◽  
Author(s):  
B. D. Nelson ◽  
L. L. Domier
Keyword(s):  
North Dakota ◽  
Mosaic Virus ◽  
Soybean Mosaic Virus ◽  
Oilseed Crop ◽  
Rt Pcr ◽  
High Concentration ◽  
Grid Pattern ◽  
First Report ◽  
History Of ◽  
Das Elisa

Soybean, Glycine max L, is grown on 1,420,000 ha in North Dakota and is the most important oilseed crop in the state. Viruses in soybean have not previously been reported from North Dakota (2). In July and August of 2007, 64 soybean fields in Cass, Richland, and Sargent counties in southeastern North Dakota were surveyed for Soybean mosaic virus (SMV). These counties have a high concentration of soybean hectares, a long history of soybean production, and soybean aphid infestations that were observed in 2004 and 2006. Fields were sampled with a grid pattern across the area with at least 8 km (5 miles) between fields. A transect of approximately 60 m through each field was made and 20 leaves were collected at random. Sap was extracted in phosphate buffer and stored at –80°C until tested first using double antibody sandwich (DAS)-ELISA with positive controls and reagents and protocol from Agdia Inc. (Elkhart, IN). Using DAS-ELISA, SMV was detected in 19 of the 64 soybean fields sampled. To confirm the presence of SMV, 12 samples that were positive for SMV by DAS-ELISA also were tested by reverse transcription (RT)-PCR. RNA was extracted from sap by a Qiagen RNeasy Plant Mini Kit (Germantown, MD), reverse transcribed, and amplified with SuperScrip III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen Inc., Carlsbad, CA) and SMV-specific primers (5′-TTCAGCACAATGGGTGAGGATG-3′ and 5′-AATTCTGTGTGGCTTGATGTTGC-3′) (1). Eight of the twelve ELISA-positive samples were positive for SMV by RT-PCR, confirming the presence of SMV in the samples. To our knowledge, this is the first report of SMV infecting soybean in North Dakota. References: (1) L. L. Domier et al. (Abstr.). Phytopathology 98(suppl.):S47, 2008. (2) B. D. Nelson and G. Danielson. (Abstr.). Phytopathology 95(suppl.):S164, 2005.

scholarly journals First Report of Cucumber mosaic virus on Melon in Bosnia and Herzegovina

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
V. Trkulja ◽  
D. Kovačić ◽  
B. Ćurković ◽  
A. Vučurović, I. Stanković ◽  
A. Bulajić ◽  
...  
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Bosnia And Herzegovina ◽  
Cucumis Melo ◽  
Cucurbita Pepo ◽  
Yellow Mosaic Virus ◽  
Rt Pcr ◽  
First Report ◽  
Negative Controls ◽  
Das Elisa

During July 2012, field-grown melon plants (Cucumis melo L.) with symptoms of mosaic, chlorotic mottling, and vein banding as well as blistering and leaf malformation were observed in one field in the locality of Kladari (municipality of Doboj, Bosnia and Herzegovina). Disease incidence was estimated at 60%. A total of 20 symptomatic plants were collected and tested with double-antibody sandwich (DAS)-ELISA using commercial polyclonal antisera (Bioreba AG, Reinach, Switzerland) against four the most commonly reported melon viruses: Cucumber mosaic virus (CMV), Watermelon mosaic virus (WMV), Zucchini yellow mosaic virus (ZYMV), and Papaya ringspot virus (PRSV) (1,3). Commercial positive and negative controls were included in each assay. Only CMV was detected serologically in all screened melon samples. Sap from an ELISA-positive sample (162-12) was mechanically inoculated to test plants using 0.01 M phosphate buffer (pH 7.0). The virus caused necrotic local lesions on Chenopodium amaranticolor 5 days after inoculation, while mild to severe mosaic was observed on Nicotiana rustica, N. glutinosa, N. tabacum ‘Samsun,’ Cucurbita pepo ‘Ezra F1,’ and Cucumis melo ‘Ananas’ 10 to 14 days post-inoculation. All five inoculated plants of each experimental host were DAS-ELISA positive for CMV. The presence of CMV in all naturally and mechanically infected plants was further verified by conventional reverse transcription (RT)-PCR. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions and used as template in RT-PCR. RT-PCR was carried out with the One-Step RT-PCR Kit (Qiagen) using primer pair CMVCPfwd and CMVCPrev (4), amplifying the entire coat protein (CP) gene and part of 3′- and 5′-UTRs of CMV RNA 3. Total RNAs obtained from the Serbian CMV isolate from Cucurbita pepo ‘Olinka’ (GenBank Accession No. HM065510) and healthy melon leaves were used as positive and negative controls, respectively. An amplicon of the correct predicted size (871 bp) was obtained from all naturally and mechanically infected plants as well as from positive control, but not from healthy tissues. The amplified product derived from isolate 162-12 was purified with QIAquick PCR Purification Kit (Qiagen) and sequenced directly using the same primer pair as in RT-PCR (KC559757). Multiple sequence alignment of the 162-12 isolate CP sequence with those available in GenBank, conducted with MEGA5 software, revealed that melon isolate from Bosnia and Herzegovina showed the highest nucleotide identity of 99.7% (100% amino acid identity) with eight CMV isolates originating from various hosts from Serbia (GQ340670), Spain (AJ829770 and 76, AM183119), the United States (U20668, D10538), Australia (U22821), and France (X16386). Despite the fact that CMV is well established in majority of Mediterranean countries and represents an important threat for many agriculture crops, including pepper in Bosnia and Herzegovina (2), to our knowledge, this is the first report of CMV infecting melon in Bosnia and Herzegovina. Melon popularity as well as production value has been rising rapidly and the presence of CMV may have a drastic economic impact on production of this crop in Bosnia and Herzegovina. References: (1) E. E. Grafton-Cardwell et al. Plant Dis. 80:1092, 1996. (2) M. Jacquemond. Adv. Virus Res. 84:439, 2012. (3) M. Luis-Arteaga et al. Plant Dis. 82:979, 1998. (4) K. Milojević et al. Plant Dis. 96:1706, 2012.

scholarly journals First Report of Prunus necrotic ringspot virus in Peach in Mexico

Plant Disease ◽  
2008 ◽  
Vol 92 (3) ◽  
pp. 482-482 ◽  
Author(s):  
R. De La Torre-Almaraz ◽  
J. V. Montoya-Piña ◽  
S. Alcacio-Rangel ◽  
G. Camarena-Gutiérrez ◽  
M. Salazar-Segura
Keyword(s):  
Prunus Persica ◽  
Rna Extraction ◽  
Ringspot Virus ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
First Report ◽  
Field Samples ◽  
Prunus Necrotic Ringspot Virus ◽  
San Martín ◽  
Das Elisa

Peach (Prunus persica (L.) Batsch) is one of the most important fruit crops in the temperate regions of Mexico. In 2006, during a survey conducted in commercial peach orchards in Puebla, Mexico for viral diseases, many trees were observed with foliar symptoms that included yellow mottle, ringspot, line patterns, and mosaic. Samples (flowers, young shoot tips, and leaves) were collected from 120 symptomatic trees in three locations (San Martin Texmelucan, Domingo Arenas, and Tepetzala). All samples were tested using double-antibody sandwich (DAS)-ELISA kits (Agdia, Inc., Elkhart, IN) for the presence of the following viruses: Apple mosaic virus, Plum pox virus, Prune dwarf virus, and Prunus necrotic ringspot virus (PNRSV). Sap extracts from young symptomatic leaves and shoots were used to mechanically inoculate Chenopodium quinoa, C. amaranticolor, Gomphrena globosa, Nicotiana tabacum cv. Xanthi, N. glutinosa, N. clevelandii, N. benthamiana, Datura stramonium, Capsicum annuum, and Solanum lycopersicum. Plants were kept in a greenhouse with approximate temperatures of 25 to 35°C, humidity of 70%, and 12 h of light. Sap extracts were also used for dsRNA extraction and analyses (2) and RNA extraction for use in reverse transcription (RT)-PCR with the Access RT-PCR system (Promega, Madison, WI) and primers that annealed to a conserved region in the PNRSV coat protein gene (1). The expected size amplicons of approximately 450 bp were generated from all field-collected samples. The PCR products from three geographically distinct PNRSV isolates (Domingo Arenas [Accession No. DQ979004], Tepetzala [Accession No. DQ979005], and San Martin Texmelucan [Accession No. EF456771]) were directly sequenced with a Genetic Analyzer 3100 (Applied Biosystems, Foster City, CA) and their nucleotide and deduced amino acids sequences were more than 93% identical to corresponding sequences of PNRSV available in the NCBI/GenBank database. PNRSV was the only virus detected by DAS-ELISA in flowers and young shoots from 60 of the symptomatic field samples tested from the three locations. DsRNA banding patterns were obtained from 40 field-collected symptomatic samples; all showed three bands of approximately 3.6, 2.5, and 1.8 kb, the expected sizes for RNAs 1, 2, and 3 of PNRSV, respectively. DsRNAs were not detected in asymptomatic plants. PNRSV transmission by mechanical inoculation induced mosaic symptoms in N. tabacum cv. Xanthi and necrotic local lesions in G. globosa. Although G. globosa is reported to be a systemic host of PNRSV and N. tabacum is not reported to be a host, symptomatic plants were positive for PNRSV in DAS-ELISA tests. It is possible that there was an additional virus not detected in our assays that was responsible for the unexpected reactions in the host range studies. To our knowledge, this is the first report of PNRSV in peach in Mexico. References: (1) D. J. MacKenzie et al. Plant Dis. 81:222, 1997. (2) R. A. Valverde et al. Plant Dis. 74:255,1990.

scholarly journals First Report of Cucumber mosaic virus Infecting Peperomia tuisana in Serbia

Plant Disease ◽  
2013 ◽  
Vol 97 (7) ◽  
pp. 1004-1004 ◽  
Author(s):  
K. Milojević ◽  
I. Stanković ◽  
A. Vučurović ◽  
D. Ristić ◽  
D. Milošević ◽  
...  
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Disease Incidence ◽  
Impatiens Necrotic Spot Virus ◽  
Rt Pcr ◽  
Test Species ◽  
First Report ◽  
Cp Gene ◽  
Negative Controls ◽  
Das Elisa

Peperomia tuisana C.DC. ex Pittier (family Piperaceae) is an attractive succulent grown as an ornamental. Despite its tropical origins, it can be successfully grown indoors in any climate. In March 2012, three samples of P. tuisana showing virus-like symptoms were collected from a commercial greenhouse in Zemun (District of Belgrade, Serbia) in which estimated disease incidence was 80%. Infected plants showed symptoms including necrotic ringspots and line patterns that enlarged and caused necrosis of leaves. A serious leaf drop led to growth reduction and even death of the plant. Leaves from three symptomatic P. tuisana plants were sampled and analyzed by double-antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba AG, Reinach, Switzerland) against the most common viral pathogens of ornamentals: Cucumber mosaic virus (CMV), Tomato spotted wilt virus (TSWV), and Impatiens necrotic spot virus (INSV) (1,2). Commercial positive and negative controls were included in each ELISA. Serological analyses showed that all plants were positive for CMV and negative for TSWV and INSV. The ELISA-positive sample (isolate 1-12) was mechanically inoculated onto five plants each of three test species as well as of healthy young P. tuisana using 0.01 M phosphate buffer (pH 7). Chlorotic local lesions on Chenopodium quinoa and severe mosaic and leaf malformations were observed on all inoculated Nicotiana tabacum ‘Samsun’ and N. glutinosa. Also, the virus was successfully mechanically transmitted to P. tuisana that reacted with symptoms identical to those observed on the original host plants. All mechanically inoculated plants were positive for CMV in DAS-ELISA. For further confirmation of CMV infection, reverse transcription (RT)-PCR was performed on extracts made from symptomatic P. tuisana, N. tabacum ‘Samsun,’ and N. glutinosa leaf materials. Total RNAs were extracted with the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and RT-PCR was carried out using One-Step RT-PCR Kit (Qiagen). A CMV-specific primer pair, CMVCPfwd and CMVCPrev (3), which amplifies an 871-bp fragment of the entire coat protein (CP) gene and part of 3′- and 5′-UTRs, were used for both amplification and sequencing. Total RNAs obtained from the Serbian CMV isolate (HM065510) and healthy P. tuisana were used as positive and negative controls, respectively. A product of the correct predicted size was obtained in all naturally and mechanically infected plants, as well as positive control. No amplicon was recorded in the healthy control. The amplified product derived from isolate 1-12 was purified (QIAquick PCR Purification Kit, Qiagen), directly sequenced in both directions, deposited in GenBank (KC505441), and analyzed by MEGA5 software (4). Sequence comparison of the complete CP gene (657 nt) revealed that the Serbian isolate 1-12 shared the highest nucleotide identity of 99.1% (99.5% amino acid identity) with the Japanese isolate (AB006813). To our knowledge, this is the first report on the occurrence of CMV in P. tuisana in Serbia. This is also an important discovery since P. tuisana is commonly grown together with other ornamental hosts of CMV, and thus could represent a serious threat for future expansion of CMV in the greenhouse floriculture industry in Serbia. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) S. Flasinski et al. Plant Dis. 79:843, 1995. (3) K. Milojevic et al. Plant Dis. 96:1706, 2012. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.

Sign in / Sign up

Export Citation Format

Share Document