scholarly journals First Report of Fusarium Head Blight of Wheat Caused by Fusarium sacchari in China

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 160-160 ◽  
Author(s):  
J.-H. Wang ◽  
X.-D. Peng ◽  
S.-H. Lin ◽  
A.-B. Wu ◽  
S.-L. Huang
Keyword(s):  
Fusarium Head Blight ◽  
Yangtze River ◽  
Fusarium Species ◽  
Gene Sequencing ◽  
Morphological Characteristics ◽  
Distilled Water ◽  
The Yangtze River ◽  
Head Blight ◽  
Average Growth ◽  
First Report

Fusarium head blight (FHB), or scab, caused by Fusarium species, is an economically devastating disease of wheat and other cereal crops worldwide. FHB epidemics in wheat occur frequently in China, especially along the middle and lower reaches of the Yangtze River, including Jiangsu and Shanghai. In 2013, wheat spikes showing clear FHB symptoms were collected from fields in Jiangsu and Shanghai. Symptomatic seeds were surface-sterilized for 1 min with a 5% sodium hypochlorite solution and dipping in 70% ethanol for 30 s, then rinsed three times in sterile distilled water and dried. They were placed onto potato dextrose agar (PDA) and incubated for 3 to 5 days at 28°C in the dark. Fungal colonies displaying morphological characteristics of Fusarium spp. (1,2) were purified by the single-spore technique and characterized at the species level by morphological observations (1,2) and translation elongation factor 1-α (TEF) gene sequencing. The results indicated that members of the Fusarium graminearum clade were predominant on wheat, while the morphological characteristics of 16 isolates were found to be identical to those of F. sacchari (1,2). Colonies on PDA were densely cottony, initially pale but becoming violet with age. The average growth rate was 6 to 8 mm per day at 25°C in the dark. Reverse pigmentation was brownish red to violet-brown. Microconidia, abundant in the aerial mycelium and formed in false heads, were oval to ellipsoidal in shape, primarily zero-septate, measuring 5.7 to 18.8 (average 10.6) μm in length. Macroconidia were slender, three- to five-septate, with a curved apical cell and a poorly developed basal cell, 26.3 to 68.9 (average 44.0) μm in length. No chlamydospores were observed. Two F. sacchari strains (Y37 and S43), isolated from Jiangsu and Shanghai, respectively, were investigated by sequence comparison of their partial TEF gene sequences (Accession Nos. KM233195 and KM233196). BLASTn analysis of the TEF sequences obtained with sequences available in the GenBank database revealed 99.8 and 99.5% sequence identity to F. sacchari (GenBank Accession Nos. JF740708 and JF740709). Pathogenicity tests were conducted by injecting 10 μl of a spore suspension (5 × 105 spores/ml) into wheat florets (20 per isolate of cv. Yangmai16), which were then grown under field conditions in Shanghai. Control plants were inoculated with sterile distilled water. Spikes were harvested and evaluated 14 days post-inoculation. Reddish white mold was observed on inoculated wheat spikes; in addition, spikelets adjacent to the inoculation point and the infected florets were brown. No symptoms were observed on water controls. Koch's postulates were fulfilled by reisolating the pathogen from infected florets and identifying them by TEF gene sequencing. F. sacchari is the cause of an important disease of sugar cane, pokkah boeng (1), and has been reported to produce the mycotoxin beauvericin, which causes toxicosis in human and other animals (3). To our knowledge, this is the first report of F. sacchari causing wheat head blight in China. The report contributes to an improved understanding of the composition of Fusarium species on wheat in the lower reaches of the Yangtze River in China, which will be useful for exploring appropriate disease management strategies in this region. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (2) J. F. Leslie et al. Mycologia 97:718, 2005. (3) A. Moretti et al. Int. J. Food Microbiol. 118:158, 2007.

scholarly journals First Report of Fusarium Maize Ear Rot Caused by Fusarium kyushuense in China

Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 279-279 ◽  
Author(s):  
J.-H. Wang ◽  
H.-P. Li ◽  
J.-B. Zhang ◽  
B.-T. Wang ◽  
Y.-C. Liao
Keyword(s):  
Fusarium Species ◽  
Morphological Characteristics ◽  
Distilled Water ◽  
Ear Rot ◽  
Tubulin Gene ◽  
Average Growth ◽  
First Report ◽  
Maize Ear Rot ◽  
Maize Ear ◽  
Β Tubulin

From September 2009 to October 2012, surveys to determine population structure of Fusarium species on maize were conducted in 22 provinces in China, where the disease incidence ranged from 5 to 20% in individual fields. Maize ears with clear symptoms of Fusarium ear rot (with a white to pink- or salmon-colored mold at the ear tip) were collected from fields. Symptomatic kernels were surface-sterilized (1 min in 0.1% HgCl2, and 30 s in 70% ethanol, followed by three rinses with sterile distilled water), dried, and placed on PDA. After incubation for 3 to 5 days at 28°C in the dark, fungal colonies displaying morphological characteristics of Fusarium spp. (2) were purified by transferring single spores and identified to species level by morphological characteristics (2), and DNA sequence analysis of translation elongation factor-1α (TEF) and β-tubulin genes. A large number of Fusarium species (mainly F. graminearum species complex, F. verticillioides, and F. proliferatum) were identified. These Fusarium species are the main causal agents of maize ear rot (2). Morphological characteristics of six strains from Anhui, Hubei, and Yunnan provinces were found to be identical to those of F. kyushuense (1), which was mixed with other Fusarium species in the natural infection in the field. Colonies grew fast on PDA with reddish-white and floccose mycelia. The average growth rate was 7 to 9 mm per day at 25°C in the dark. Reverse pigmentation was deep red. Microconidia were obovate, ellipsoidal to clavate, and 5.4 to 13.6 (average 8.8) μm in length. Macroconidia were straight or slightly curved, 3- to 5-septate, with a curved and acute apical cell, and 26.0 to 50.3 (average 38.7) μm in length. No chlamydospores were observed. Identity of the fungus was further investigated by sequence comparison of the partial TEF gene (primers EF1/2) and β-tubulin gene (primers T1/22) of one isolate (3). BLASTn analysis of the TEF amplicon (KC964133) and β-tubulin gene (KC964152) obtained with cognate sequences available in GenBank database revealed 99.3 and 99.8% sequence identity, respectively, to F. kyushuense. Pathogenicity tests were conducted twice by injecting 2 ml of a prepared spore suspension (5 × 105 spores/ml) into maize ears (10 per isolate of cv. Zhengdan958) through silk channel 4 days post-silk emergence under field conditions in Wuhan, China. Control plants were inoculated with sterile distilled water. The ears were harvested and evaluated 30 days post-inoculation. Reddish-white mold was observed on inoculated ears and the infected kernels were brown. No symptoms were observed on water controls. Koch's postulates were fulfilled by re-isolating the pathogen from infected kernels. F. kyushuense, first described on wheat in Japan (1), has also been isolated from rice seeds in China (4). It was reported to produce both Type A and Type B trichothecene mycotoxins (1), which cause toxicosis in animals. To our knowledge, this is the first report of F. kyushuense causing maize ear rot in China and this disease could represent a serious risk of yield losses and mycotoxin contamination in maize and other crops. The disease must be considered in existing disease management practices. References: (1) T. Aoki and K. O'Donnell. Mycoscience 39:1, 1998. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (3) F. Van Hove et al. Mycologia 103:570, 2011. (4) Z. H. Zhao and G. Z. Lu. Mycotaxon 102:119, 2007.

scholarly journals First Report of Fusarium pseudograminearum from Wheat Heads with Fusarium Head Blight in North China Plain

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 156-156 ◽  
Author(s):  
F. Xu ◽  
Y. L. Song ◽  
G. Q. Yang ◽  
J. M. Wang ◽  
L. L. Liu ◽  
...  
Keyword(s):  
Fusarium Head Blight ◽  
North China Plain ◽  
North China ◽  
Temporal Dynamics ◽  
Morphological Characteristics ◽  
Distilled Water ◽  
Head Blight ◽  
Single Spore ◽  
Winter Cereal ◽  
First Report

Wheat (Triticum aestivum L.), the most widely grown winter cereal crop in China, was grown on 24.3 million hectares in 2012. There was an outbreak of Fusarium head blight in 2012, and it was prevalent in 2013 in North China Plain, the largest area producing winter wheat in China. In 2013, a total of 213 Fusarium graminearum-like isolates were collected from diseased wheat heads in 33 fields in 17 counties in Henan province. The pathogen was isolated from the base of Fusarium-damaged spikelets on potato dextrose agar (PDA) after being surface-sterilized (70% EtOH for 30 s and 3% NaClO for 1.5 min) and rinsed three times in sterilized distilled water. After 3 days, the mycelia were transferred to fresh PDA and purified by the single-spore isolation method. Species were identified based on morphological characteristics (2), and sequence analysis of the translation elongation factor-1α (TEF) and trichothecene 3-O-acetyltransferase (Tri 101) gene (3). The results indicated that F. graminearum species complex (97.2%) is the main causal agent of Fusarium head blight in this region. However, four strains (2%) from the two fields in Jiao Zuo and Xin Xiang counties were found to be identical to F. pseudograminearum. The four (13JZ3-1, 13JZ3-2, 13XX1-2, and 13XX1-6) isolates of F. pseudograminearum were transferred onto carnation leaf agar (CLA) and incubated at 20°C under black light blue illumination. On CLA, macroconidia were abundant, relatively slender, curved to almost straight, commonly six- to seven-septate, and averaged 49.7 × 5.0 μm. Microconidia were not observed. Chlamydospores were observed after 4 weeks. The fungus was initially identified as F. graminearum on the basis of morphology of the asexual stage (2). However, the TEF sequences (Accession nos. KJ863322 to KJ863325) showed 99 to 100% similarity with several F. pseudograminearum sequences (e.g., AF212468, AF212469, and AF212470); the Tri 101 sequences (KJ863326 to KJ863329) showed 99 to 100% similarity with accession nos. AF212615 and AF212616 of F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). To complete Koch's postulates, the pathogenicity of the fungus was tested by spraying five healthy inflorescences (average of 19 spikelets per spike) of wheat cultivar Zhoumai 18 with a 5-ml suspension (5 × 104 conidia per milliliter). Another five healthy inflorescences were sprayed with sterile distilled water. Plants were placed in a growth chamber with a 12-h photoperiod at 22°C, covered with polyethylene bags that were removed after 2 days. Seven days later, while control inflorescences were asymptomatic, inoculated inflorescences showed a mean of 10 bleached spikelets per spike. By using the methodology described above, the fungus was re-isolated from infected spikelets of inoculated wheat heads but not from the controls. To our knowledge, this is the first report of F. pseudograminearum from diseased wheat heads in China. Further investigation is needed to gain a better understanding of the spatial and temporal dynamics of this new pathogen. References: (1) T. Aoki and K. O'Donnell. Mycologia 91:597, 1999. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Oxford, UK, 2006. (3) R. H. Proctor et al. Mol. Microbiol. 74:1128, 2009.

scholarly journals First Report of Pepper Fruit Rot Caused by Fusarium concentricum in China

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1657-1657 ◽  
Author(s):  
J. H. Wang ◽  
Z. H. Feng ◽  
Z. Han ◽  
S. Q. Song ◽  
S. H. Lin ◽  
...  
Keyword(s):  
Fusarium Species ◽  
Fruit Rot ◽  
Post Inoculation ◽  
Distilled Water ◽  
Conidial Suspension ◽  
Average Growth ◽  
First Report ◽  
Control Fruit ◽  
Pepper Fruit ◽  
Fruit Samples

Pepper (Capsicum annuum L.) is an important vegetable crop worldwide. Some Fusarium species can cause pepper fruit rot, leading to significant yield losses of pepper production and, for some Fusarium species, potential risk of mycotoxin contamination. A total of 106 diseased pepper fruit samples were collected from various pepper cultivars from seven provinces (Gansu, Hainan, Heilongjiang, Hunan, Shandong, Shanghai, and Zhejiang) in China during the 2012 growing season, where pepper production occurs on approximately 25,000 ha. Pepper fruit rot symptom incidence ranged from 5 to 20% in individual fields. Symptomatic fruit tissue was surface-sterilized in 0.1% HgCl2 for 1 min, dipped in 70% ethanol for 30 s, then rinsed in sterilized distilled water three times, dried, and plated in 90 mm diameter petri dishes containing potato dextrose agar (PDA). After incubation for 5 days at 28°C in the dark, putative Fusarium colonies were purified by single-sporing. Forty-three Fusarium strains were isolated and identified to species as described previously (1,2). Morphological characteristics of one strain were identical to those of F. concentricum. Aerial mycelium was reddish-white with an average growth rate of 4.2 to 4.3 mm/day at 25°C in the dark on PDA. Pigments in the agar were formed in alternating red and orange concentric rings. Microconidia were 0- to 1-septate, mostly 0-septate, and oval, obovoid to allantoid. Macroconidia were relatively slender with no significant curvature, 3- to 5-septate, with a beaked apical cell and a foot-shaped basal cell. To confirm the species identity, the partial TEF gene sequence (646 bp) was amplified and sequenced (GenBank Accession No. KC816735). A BLASTn search with TEF gene sequences in NCBI and the Fusarium ID databases revealed 99.7 and 100% sequence identity, respectively, to known TEF sequences of F. concentricum. Thus, both morphological and molecular criteria supported identification of the strain as F. concentricum. This strain was deposited as Accession MUCL 54697 (http://bccm.belspo.be/about/mucl.php). Pathogenicity of the strain was confirmed by inoculating 10 wounded, mature pepper fruits that had been harvested 70 days after planting the cultivar Zhongjiao-5 with a conidial suspension (1 × 106 spores/ml), as described previously (3). A control treatment consisted of inoculating 10 pepper fruits of the same cultivar with sterilized distilled water. The fruit were incubated at 25°C in a moist chamber, and the experiment was repeated independently in triplicate. Initially, green to dark brown lesions were observed on the outer surface of inoculated fruit. Typical soft-rot symptoms and lesions were observed on the inner wall when the fruit were cut open 10 days post-inoculation. Some infected seeds in the fruits were grayish-black and covered by mycelium, similar to the original fruit symptoms observed at the sampling sites. The control fruit remained healthy after 10 days of incubation. The same fungus was isolated from the inoculated infected fruit using the method described above, but no fungal growth was observed from the control fruit. To our knowledge, this is the first report of F. concentricum causing a pepper fruit rot. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (2) K. O'Donnell et al. Proc. Nat. Acad. Sci. USA 95:2044, 1998. (3) Y. Yang et al. 2011. Int. J. Food Microbiol. 151:150, 2011.

scholarly journals First Report on the Occurrence of Fusarium langsethiae Isolated from Wheat Kernels in Poland

Plant Disease ◽  
2008 ◽  
Vol 92 (3) ◽  
pp. 488-488 ◽  
Author(s):  
A. Lukanowski ◽  
L. Lenc ◽  
C. Sadowski
Keyword(s):  
Growth Rate ◽  
Fusarium Head Blight ◽  
Species Identification ◽  
Uv Light ◽  
Average Length ◽  
Fusarium Species ◽  
Head Blight ◽  
Single Spore ◽  
First Report ◽  
Sequence Characterized Amplified Region

Numerous Fusarium species have been associated with Fusarium head blight of wheat. In Poland, Fusarium poae was reported as the dominant species isolated from wheat grain during seasons with low amounts of rainfall during anthesis (1). F. langsethiae was described as a new toxigenic Fusarium species (3) and causal agent of Fusarium head blight (2), which has been isolated from infected oats, wheat, and barley in northern and central Europe (Norway, Austria, Germany, Czech Republic, Denmark, and England) (2). On the basis of morphological similarities, F. langsethiae has long been identified as a “powdery” form of F. poae. However, F. langsethiae produces type A trichothecene toxins such as T-2, whereas F. poae produces nivalenol and other 8-keto trichothecenes, scirpentriol, and 15-acetoxyscirpenol. In 2006, we obtained several isolates of F. langsethiae from kernels collected from winter wheat ears with head blight symptoms. Isolates were collected in the central (Sobiejuchy 52°54′N, 17°43′E; Minikowo 53°29′N, 17°56′E) and northern (Radostowo 53°59′N, 18°45′E) regions of Poland. Strains were isolated on potato dextrose agar (PDA) medium (pH 5.5). Further analyses were conducted on single-spore isolates. Initial species identification of all isolates was conducted on the basis of morphological features. The strains were grown in darkness at 25°C on PDA in plastic petri dishes to diagnose colony color, odor, and growth rate. The cultures also were incubated on saltwater nutrient agar (SNA) at 25°C for 7 days in near-UV light (Philips TLD 36W/08) and darkness in a 12/12-h cycle to promote conidia formation. The calculated average mycelial growth rate per day was based on the difference in millimeters between the colony diameters after 4 and 7 days of incubation. Growth rates ranged from 5.4 to 10.3 mm/day for nine strains. Mycelium was whitish or pinkish white, sparse, and 1 to 3 mm high with no odor. All colonies showed a powdery mycelium surface. Microconidia was napiform or globose, nonseptate, sporadically 1-septate, with an average length of 6.4 μm (range 3.9 to 13.7 μm) and width of 5.6 μm (range 2.9 to 8.8 μm). Microconidia were formed in heads, borne on unbranched or branched monophialides that were 8.5 to 16.3 μm long. All strains had slim, bent monophialides, typical for F. langsethiae, and always a few, short, thick, and squat ones resembling F. poae. In young cultures, monophialides may be formed directly on hyphae. Formation of macroconidia, sclerotia, and chlamydospores were not observed after 3 weeks of incubation. Species identification was confirmed by PCR assay with the use of SCAR (sequence characterized amplified region) primers producing a 310-bp DNA fragment (4), which was deposited in GenBank (Accession No. EU088404). To our knowledge, this is the first report of F. langsethiae in Poland. References: (1) C. Sadowski et al. J. Appl. Genet. 43A:69, 2002. (2) M. Torp and A. Adler. Int. J. Food Microbiol. 95:241, 2004. (3) M. Torp and H. I. Nirenberg. Int. J. Food Microbiol. 95:247, 2004. (4) A. Wilson et al. FEMS Microbiol. Lett. 233:69, 2004.

scholarly journals First Report of Fusarium Wilt in the Broomrape Parasite Growing on Brassica spp. in India

Plant Disease ◽  
2011 ◽  
Vol 95 (1) ◽  
pp. 75-75 ◽  
Author(s):  
P. Sharma ◽  
P. K. Rai ◽  
S. A. Siddiqui ◽  
J. S. Chauhan
Keyword(s):  
Fusarium Species ◽  
Morphological Characteristics ◽  
Control Measures ◽  
Distilled Water ◽  
State University ◽  
Single Spore ◽  
First Report ◽  
Brassica Spp ◽  
Initial Symptoms ◽  
Below Ground

Broomrape (Orobanche aegyptiaca Pers.), an important obligate root parasitic weed in India, has a wide host range including several members of the Solanaceae, Leguminaceae, and Brassicaceae families, among others. Orobanche plants produce thousands of tiny seeds (250 × 300 μm), which can remain viable in the soil for as long as 13 years (3). Rapeseed-mustard (Brassica spp.) is one of the major oilseed crops in India, cultivated on 5.77 million ha with 6.59 million t produced during 2009–2010. Broomrape has been observed in India as a major angiospermic parasitic plant on rapeseed-mustard, tobacco, tomato, and potato. During a field visit to an experimental farm at the Directorate of Rapeseed-Mustard Research, Bharatpur (27°12′N, 77°27′E) in the winter of 2009-2010, symptoms of wilt disease were observed on Orobanche plants, 32.6% of which had wilted completely following root infection. Initial symptoms appeared as a browning of the flowering stalk with wilting. Direct observation of below ground plant parasite tissues revealed a necrosis starting at the radical and advancing to the collar region that shredded later on. Tissue fragments, excised from the internal portions of the diseased tissue, were surface sterilized with 0.1% HgCl2, plated on 2% potato dextrose agar (PDA) adjusted to pH 7.0, and incubated at 22 ± 2°C for 7 days. The colonies that grew on PDA plates produced a bright purple color. Single-spore culturing of the fungus yielded Fusarium solani on the basis of morphological characteristics (2). The Fungal Identification Service, Mycology and Plant Pathology Group, Agharkar Research Institute, Pune, India (Accession No. 2156) confirmed the identity. The pathogenicity of the fungus was tested by inoculating five healthy Orobanche plants that were parasitizing Brassica spp. at the radicle region with 10-ml spore suspensions (2 × 105 conidia/ml of sterile distilled water) derived from 7-day-old cultures of the fungus. Control plants were treated with sterile distilled water. F. solani-inoculated radicles developed typical wilting symptoms within 2 weeks of treatment, while the control as well as the Brassica spp. plants remained healthy. F. solani was reisolated from inoculated wilted plants, thus fulfilling Koch's postulates. To our knowledge, on the basis of the literature, this is the first report from India showing that F. solani infects O. aegyptica on Brassica spp. There are reports of fungi (50 different species) infecting different hosts in Southern Italy, including F. oxysporum and F. solani, which have been found to be pathogenic to O. ramose. The most pathogenic Fusarium isolates significantly increased the number of dead spikes of broomrape (1). Control of Orobanche spp. poses a challenge because of the lack of effective and economic control measures. F. solani thus offers a potentially promising management strategy that should be explored in the future for the control of O. aegyptiaca. References: (1) A. Boari et al. Biol. Control 30:212, 2004. (2) P. E. Nelson et al. Fusarium Species: An Illustrated Manual for Identification. 1st ed. Pennsylvania State University Press, University Park, 1983. (3) M.C. Press et al. Parasitic Plants. Chapman and Hall, London, UK, 1995.

scholarly journals Screening of Durum Wheat (Triticum turgidum L. subsp. durum (Desf.) Husn.) Italian Cultivars for Susceptibility to Fusarium Head Blight Incited by Fusarium graminearum

Plants ◽  
2020 ◽  
Vol 10 (1) ◽  
pp. 68
Author(s):  
Gaetano Bentivenga ◽  
Alfio Spina ◽  
Karim Ammar ◽  
Maria Allegra ◽  
Santa Olga Cacciola
Keyword(s):  
Durum Wheat ◽  
Fusarium Head Blight ◽  
Fusarium Graminearum ◽  
Triticum Turgidum ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Pcr Amplification ◽  
Conidial Suspension ◽  
Head Blight ◽  
Italian Origin

In 2009, a set of 35 cultivars of durum wheat (Triticum turgidum L. subsp. durum (Desf.) Husn.) of Italian origin was screened for fusarium head blight (FHB) susceptibility at CIMMYT (Mexico) and in the 2019–20 cropping season, 16 of these cultivars, which had been included in the Italian National Plant Variety Register, were tested again in southern and northern Italy. Wheat cultivars were artificially inoculated during anthesis with a conidial suspension of Fusarium graminearum sensu lato using a standard spray inoculation method. Inoculum was a mixture of mono-conidial isolates sourced in the same areas where the trials were performed. Isolates had been characterized on the basis of morphological characteristics and by DNA PCR amplification using a specific primer set and then selected for their virulence and ability to produce mycotoxins. The susceptibility to FHB was rated on the basis of the disease severity, disease incidence and FHB index. Almost all of the tested cultivars were susceptible or very susceptible to FHB with the only exception of “Duprì”, “Tiziana” and “Dylan” which proved to be moderately susceptible. The susceptibility to FHB was inversely correlated with the plant height and flowering biology, the tall and the late heading cultivars being less susceptible.

scholarly journals First Report of Flyspeck Caused by Zygophiala wisconsinensis on Sweet Persimmon Fruit in Korea

Plant Disease ◽  
2011 ◽  
Vol 95 (5) ◽  
pp. 616-616 ◽  
Author(s):  
J. Kim ◽  
O. Choi ◽  
J.-H. Kwon
Keyword(s):  
Disease Incidence ◽  
Morphological Characteristics ◽  
Its Rdna ◽  
Control Treatment ◽  
Diospyros Kaki ◽  
Distilled Water ◽  
First Report ◽  
Persimmon Fruit ◽  
Fungal Isolates ◽  
Agar Disc

Sweet persimmon (Diospyros kaki L.), a fruit tree in the Ebenaceae, is cultivated widely in Korea and Japan, the leading producers worldwide (2). Sweet persimmon fruit with flyspeck symptoms were collected from orchards in the Jinju area of Korea in November 2010. The fruit had fungal clusters of black, round to ovoid, sclerotium-like fungal bodies with no visible evidence of a mycelial mat. Orchard inspections revealed that disease incidence ranged from 10 to 20% in the surveyed area (approximately 10 ha) in 2010. Flyspeck symptoms were observed on immature and mature fruit. Sweet persimmon fruit peels with flyspeck symptoms were removed, dried, and individual speck lesions transferred to potato dextrose agar (PDA) and cultured at 22°C in the dark. Fungal isolates were obtained from flyspeck colonies on 10 sweet persimmon fruit harvested from each of three orchards. Fungal isolates that grew from the lesions were identified based on a previous description (1). To confirm identity of the causal fungus, the complete internal transcribed spacer (ITS) rDNA sequence of a representative isolate was amplified and sequenced using primers ITS1 and ITS4 (4). The resulting 552-bp sequence was deposited in GenBank (Accession No. HQ698923). Comparison with ITS rDNA sequences showed 100% similarity with a sequence of Zygophiala wisconsinensis Batzer & Crous (GenBank Accession No. AY598855), which infects apple. To fulfill Koch's postulates, mature, intact sweet persimmon fruit were surface sterilized with 70% ethanol and dried. Three fungal isolates from this study were grown on PDA for 1 month. A colonized agar disc (5 mm in diameter) of each isolate was cut from the advancing margin of a colony with a sterilized cork borer, transferred to a 1.5-ml Eppendorf tube, and ground into a suspension of mycelial fragments and conidia in a blender with 1 ml of sterile, distilled water. The inoculum of each isolate was applied by swabbing a sweet persimmon fruit with the suspension. Three sweet persimmon fruit were inoculated per isolate. Three fruit were inoculated similarly with sterile, distilled water as the control treatment. After 1 month of incubation in a moist chamber at 22°C, the same fungal fruiting symptoms were reproduced as observed in the orchards, and the fungus was reisolated from these symptoms, but not from the control fruit, which were asymptomatic. On the basis of morphological characteristics of the fungal colonies, ITS sequence, and pathogenicity to persimmon fruit, the fungus was identified as Z. wisconsinensis (1). Flyspeck is readily isolated from sweet persimmon fruit in Korea and other sweet persimmon growing regions (3). The exposure of fruit to unusual weather conditions in Korea in recent years, including drought, and low-temperature and low-light situations in late spring, which are favorable for flyspeck, might be associated with an increase in occurrence of flyspeck on sweet persimmon fruit in Korea. To our knowledge, this is the first report of Z. wisconsinensis causing flyspeck on sweet persimmon in Korea. References: (1) J. C. Batzer et al. Mycologia 100:246, 2008. (2) FAOSTAT Database. Retrieved from http://faostat.fao.org/ , 2008. (3) H. Nasu and H. Kunoh. Plant Dis. 71:361, 1987. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.

scholarly journals First Report of Fusarium pseudograminearum Causing Fusarium Head Blight of Wheat in Hebei Province, China

Plant Disease ◽  
2016 ◽  
Vol 100 (1) ◽  
pp. 220-220 ◽  
Author(s):  
L. J. Ji ◽  
L. X. Kong ◽  
Q. S. Li ◽  
L. S. Wang ◽  
D. Chen ◽  
...  
Keyword(s):  
Fusarium Head Blight ◽  
Hebei Province ◽  
Head Blight ◽  
First Report ◽  
Fusarium Pseudograminearum

scholarly journals First report of Coniella castaneicola causing leaf blight on blueberry (Vaccinium virgatum) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Jiahao Lai ◽  
Guihong Xiong ◽  
Bing Liu ◽  
Weigang Kuang ◽  
Shuilin Song
Keyword(s):  
Molecular Identification ◽  
Morphological Characteristics ◽  
Leaf Blight ◽  
Yield Potential ◽  
Effective Control ◽  
Economic Losses ◽  
Distilled Water ◽  
First Report ◽  
Fungal Isolates ◽  
Blight Disease

Blueberry (Vaccinium virgatum), an economically important small fruit crop, is characterized by its highly nutritive compounds and high content and wide diversity of bioactive compounds (Miller et al. 2019). In September 2020, an unknown leaf blight disease was observed on Rabbiteye blueberry at the Agricultural Science and Technology Park of Jiangxi Agricultural University in Nanchang, China (28°45'51"N, 115°50'52"E). Disease surveys were conducted at that time, the results showed that disease incidence was 90% from a sampled population of 100 plants in the field, and this disease had not been found at other cultivation fields in Nanchang. Leaf blight disease on blueberry caused the leaves to shrivel and curl, or even fall off, which hindered floral bud development and subsequent yield potential. Symptoms of the disease initially appeared as irregular brown spots (1 to 7 mm in diameter) on the leaves, subsequently coalescing to form large irregular taupe lesions (4 to 15 mm in diameter) which became curly. As the disease progressed, irregular grey-brown and blighted lesion ran throughout the leaf lamina from leaf tip to entire leaf sheath and finally caused dieback and even shoot blight. To identify the causal agent, 15 small pieces (5 mm2) of symptomatic leaves were excised from the junction of diseased and healthy tissue, surface-sterilized in 75% ethanol solution for 30 sec and 0.1% mercuric chloride solution for 2 min, rinsed three times with sterile distilled water, and then incubated on potato dextrose agar (PDA) at 28°C for 5-7 days in darkness. Five fungal isolates showing similar morphological characteristics were obtained as pure cultures by single-spore isolation. All fungal colonies on PDA were white with sparse creeping hyphae. Pycnidia were spherical, light brown, and produced numerous conidia. Conidia were 10.60 to 20.12 × 1.98 to 3.11 µm (average 15.27 × 2.52 µm, n = 100), fusiform, sickle-shaped, light brown, without septa. Based on morphological characteristics, the fungal isolates were suspected to be Coniella castaneicola (Cui 2015). To further confirm the identity of this putative pathogen, two representative isolates LGZ2 and LGZ3 were selected for molecular identification. The internal transcribed spacer region (ITS) and large subunit (LSU) were amplified and sequenced using primers ITS1/ITS4 (Peever et al. 2004) and LROR/LR7 (Castlebury and Rossman 2002). The sequences of ITS region (GenBank accession nos. MW672530 and MW856809) showed 100% identity with accessions numbers KF564280 (576/576 bp), MW208111 (544/544 bp), MW208112 (544/544 bp) of C. castaneicola. LSU gene sequences (GenBank accession nos. MW856810 to 11) was 99.85% (1324/1326 bp, 1329/1331 bp) identical to the sequences of C. castaneicola (KY473971, KR232683 to 84). Pathogenicity was tested on three blueberry varieties (‘Rabbiteye’, ‘Double Peak’ and ‘Pink Lemonade’), and four healthy young leaves of a potted blueberry of each variety with and without injury were inoculated with 20 μl suspension of prepared spores (106 conidia/mL) derived from 7-day-old cultures of LGZ2, respectively. In addition, four leaves of each variety with and without injury were sprayed with sterile distilled water as a control, respectively. The experiment was repeated three times, and all plants were incubated in a growth chamber (a 12h light and 12h dark period, 25°C, RH greater than 80%). After 4 days, all the inoculated leaves started showing disease symptoms (large irregular grey-brown lesions) as those observed in the field and there was no difference in severity recorded between the blueberry varieties, whereas the control leaves showed no symptoms. The fungus was reisolated from the inoculated leaves and confirmed as C. castaneicola by morphological and molecular identification, fulfilling Koch’s postulates. To our knowledge, this is the first report of C. castaneicola causing leaf blight on blueberries in China. The discovery of this new disease and the identification of the pathogen will provide useful information for developing effective control strategies, reducing economic losses in blueberry production, and promoting the development of the blueberry industry.

scholarly journals First Report of Leaf Spot of Sweet Basil Caused by Cercospora guatemalensis in Korea

Plant Disease ◽  
2012 ◽  
Vol 96 (10) ◽  
pp. 1580-1580
Author(s):  
J. H. Park ◽  
K. S. Han ◽  
J. Y. Kim ◽  
H. D. Shin
Keyword(s):  
Leaf Spot ◽  
Morphological Characteristics ◽  
Its Region ◽  
Culture Collection ◽  
Distilled Water ◽  
First Report ◽  
Sweet Basil ◽  
Organic Farm ◽  
Leaf Spots ◽  
Close Phylogenetic Relationship

Sweet basil, Ocimum basilicum L., is a fragrant herb belonging to the family Lamiaceae. Originated in India 5,000 years ago, sweet basil plays a significant role in diverse cuisines across the world, especially in Asian and Italian cooking. In October 2008, hundreds of plants showing symptoms of leaf spot with nearly 100% incidence were found in polyethylene tunnels at an organic farm in Icheon, Korea. Leaf spots were circular to subcircular, water-soaked, dark brown with grayish center, and reached 10 mm or more in diameter. Diseased leaves defoliated prematurely. The damage purportedly due to this disease has reappeared every year with confirmation of the causal agent made again in 2011. A cercosporoid fungus was consistently associated with disease symptoms. Stromata were brown, consisting of brown cells, and 10 to 40 μm in width. Conidiophores were fasciculate (n = 2 to 10), olivaceous brown, paler upwards, straight to mildly curved, not geniculate in shorter ones or one to two times geniculate in longer ones, 40 to 200 μm long, occasionally reaching up to 350 μm long, 3.5 to 6 μm wide, and two- to six-septate. Conidia were hyaline, acicular to cylindric, straight in shorter ones, flexuous to curved in longer ones, truncate to obconically truncate at the base, three- to 16-septate, and 50 to 300 × 3.5 to 4.5 μm. Morphological characteristics of the fungus were consistent with the previous reports of Cercospora guatemalensis A.S. Mull. & Chupp (1,3). Voucher specimens were housed at Korea University herbarium (KUS). An isolate from KUS-F23757 was deposited in the Korean Agricultural Culture Collection (Accession No. KACC43980). Fungal DNA was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced. The resulting sequence of 548 bp was deposited in GenBank (Accession No. JQ995781). This showed >99% similarity with sequences of many Cercospora species, indicating their close phylogenetic relationship. Isolate of KACC43980 was used in the pathogenicity tests. Hyphal suspensions were prepared by grinding 3-week-old colonies grown on PDA with distilled water using a mortar and pestle. Five plants were inoculated with hyphal suspensions and five plants were sprayed with sterile distilled water. The plants were covered with plastic bags to maintain a relative humidity of 100% for 24 h and then transferred to a 25 ± 2°C greenhouse with a 12-h photoperiod. Typical symptoms of necrotic spots appeared on the inoculated leaves 6 days after inoculation, and were identical to the ones observed in the field. C. guatemalensis was reisolated from symptomatic leaf tissues, confirming Koch's postulates. No symptoms were observed on control plants. Previously, the disease was reported in Malawi, India, China, and Japan (2,3), but not in Korea. To our knowledge, this is the first report of C. guatemalensis on sweet basil in Korea. Since farming of sweet basil has recently started on a commercial scale in Korea, the disease poses a serious threat to safe production of this herb, especially in organic farming. References: (1) C. Chupp. A Monograph of the Fungus Genus Cercospora. Ithaca, NY, 1953. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology & Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , May 5, 2012. (3) J. Nishikawa et al. J. Gen. Plant Pathol. 68:46, 2002.

Sign in / Sign up

Export Citation Format

Share Document