scholarly journals First Report of Beet Leafhopper Transmitted Virescence Agent Phytoplasma in Capsicum annuum and Circulifer tenellus in Mexico

Plant Disease ◽  
2017 ◽  
Vol 101 (6) ◽  
pp. 1032-1032 ◽  
Author(s):  
K. D. Swisher ◽  
J. E. Munyaneza ◽  
R. Velásquez-Valle ◽  
J. Mena-Covarrubias
Keyword(s):  
Capsicum Annuum ◽  
First Report ◽  
Beet Leafhopper ◽  
Circulifer Tenellus

scholarly journals Detection of Pathogens Associated with Psyllids and Leafhoppers in Capsicum annuum L. in the Mexican States of Durango, Zacatecas, and Michoacán

Plant Disease ◽  
2018 ◽  
Vol 102 (1) ◽  
pp. 146-153 ◽  
Author(s):  
K. D. Swisher ◽  
J. E. Munyaneza ◽  
R. Velásquez-Valle ◽  
J. Mena-Covarrubias
Keyword(s):  
Capsicum Annuum ◽  
Mixed Infections ◽  
Bactericera Cockerelli ◽  
Viral Pathogens ◽  
Spiroplasma Citri ◽  
Beet Leafhopper ◽  
Circulifer Tenellus ◽  
Capsicum Annuum L ◽  
Candidatus Liberibacter ◽  
Pepper Plants

In fall 2014, 5 to 75% percent of chili and bell pepper (Capsicum annuum L.) in commercial fields located in the Mexican states of Durango, Zacatecas, and Michoacán had symptoms of deformed, small, mosaic, curled, and chlorotic leaves; shortened internodes; plant dwarfing; or phyllody and rosetting leaf tips. At the same time, leafhoppers and psyllids were observed in the fields, and more than 50 beet leafhoppers (Circulifer tenellus) and nearly 300 potato psyllids (Bactericera cockerelli) were collected from the pepper plants and adjacent weeds. Based on the insect pressure and observed symptoms, nearly 400 pepper samples were collected across this region of Mexico and tested for the presence of leafhopper- and psyllid-associated pathogens. In all, 76% of the pepper samples were found to be infected with ‘Candidatus Liberibacter solanacearum’, beet leafhopper-transmitted virescence agent (BLTVA) phytoplasma, a strain of a curtovirus, or a combination of any two or three of these pathogens. Additionally, 77% of the collected leafhoppers and 40% of the psyllids were infected with one or more of these pathogens, in addition to Spiroplasma citri. Specifically, the leafhoppers were infected with BLTVA phytoplasma, S. citri, or a strain of curtovirus. Of particular interest, potato psyllids were not only infected with ‘Ca. L. solanacearum’ but also with phytoplasmas that belong to the groups 16SrVI subgroup A and 16SrI subgroup A. The presence of mixed infections in pepper plants and the insect vectors highlights the need for growers to effectively control both leafhoppers and potato psyllids from solanaceous crops in this region of Mexico in order to prevent the spread of these bacterial and viral pathogens.

First report of tomato mosaic virus infecting chili pepper (Capsicum annuum L.) in Korea

2021 ◽  
Author(s):  
In-Sook Cho ◽  
Ju-Yeon Yoon ◽  
Eun-Young Yang ◽  
Soo-Young Chae ◽  
Bong Nam Chung ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Capsicum Annuum ◽  
Chili Pepper ◽  
Tomato Mosaic Virus ◽  
First Report ◽  
Capsicum Annuum L

scholarly journals Incidence of the Beet Leafhopper-Transmitted Virescence Agent Phytoplasma in local Populations of the Beet Leafhopper,Circulifer tenellus, in Washington State

2010 ◽  
Vol 10 (18) ◽  
pp. 1-10 ◽  
Author(s):  
Joseph E. Munyaneza ◽  
James M. Crosslin ◽  
Jeffrey E. Upton ◽  
Jeremy L. Buchman
Keyword(s):  
Washington State ◽  
Beet Leafhopper ◽  
Circulifer Tenellus ◽  
Local Populations

scholarly journals Prediction of Early Season Beet Leafhopper Populations in Southern New Mexico

2020 ◽  
Vol 21 (1) ◽  
pp. 71-76
Author(s):  
Erik Lehnhoff ◽  
Rebecca Creamer
Keyword(s):  
New Mexico ◽  
Weed Management ◽  
Broad Host Range ◽  
Insect Vector ◽  
Early Season ◽  
Beet Leafhopper ◽  
Beet Curly Top Virus ◽  
Circulifer Tenellus ◽  
Sisymbrium Irio ◽  
The Relationship

Curly top is an important widespread disease in semiarid regions that can be caused by several Curtovirus and Becurtovirus species. The strains of beet curly top virus (BCTV) have been some of the most widely reported to be associated with curly top. The viruses causing curly top are phloem limited and transmitted by the beet leafhopper (BLH), Circulifer tenellus Baker (Hemiptera: Cicadellidae). The BLH can also transmit other important pathogens such as phytoplasmas. Both the virus and insect vector have a broad host range of crops and weeds, including the winter annual weed London rocket (Sisymbrium irio L.). Prior prediction of disease would allow growers a window of opportunity to make informed management choices. A prediction model of BLH abundance was developed for southern New Mexico based on fall precipitation, which corresponds with London rocket emergence, and BLH sticky trap catch data for 2001 to 2018. Regression analyses showed positive associations between BLH numbers and October + November rainfall (P < 0.001) for two areas within southern New Mexico. A third area, where good weed management was used, had lower BLH numbers, and the relationship with precipitation was not significant (P = 0.190). Cumulative-season BLH abundance was correlated with BLH abundance in late April (r = 0.43) and late May (r = 0.56), indicating that early season knowledge of BLH abundance is useful for planning later season management. Although models based on October + November precipitation are good predictors of BLH abundance through June, they may not predict year-long BLH abundance because other environmental and biological factors contribute to subsequent BLH success and movement.

First Report of Pepper mottle virus on Capsicum annuum in Japan

2003 ◽  
Vol 69 (5) ◽  
pp. 348-350 ◽  
Author(s):  
Yoshihiro Ogawa ◽  
Kyoji Hagiwara ◽  
Hisashi Iwai ◽  
Shoichi Izumi ◽  
Kei Arai
Keyword(s):  
Capsicum Annuum ◽  
Mottle Virus ◽  
Pepper Mottle Virus ◽  
First Report

scholarly journals First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1176-1176 ◽  
Author(s):  
J. Reina ◽  
G. Morilla ◽  
E. R. Bejarano ◽  
M. D. Rodríguez ◽  
D. Janssen
Keyword(s):  
Capsicum Annuum ◽  
Blot Hybridization ◽  
Tomato Yellow Leaf ◽  
Southern Spain ◽  
Yellow Leaf ◽  
First Report ◽  
Spanish Isolate ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

scholarly journals First Report of Mesocriconema sphaerocephalum (Taylor, 1936) Loof, 1989 Associated with Bell Pepper (Capsicum annuum) in Egypt

2020 ◽  
Vol 19 (1) ◽  
pp. 19-28
Author(s):  
Zafar Handoo ◽  
Mihail Kantor ◽  
Mostafa Hammam ◽  
Moawad Mohamed ◽  
Mahfouz Abdel Gawad
Keyword(s):  
Capsicum Annuum ◽  
Bell Pepper ◽  
First Report

scholarly journals First Report of Chili Pepper (Capsicum annuum) as a Natural Host Plant for Dahlia mosaic virus

Plant Disease ◽  
2015 ◽  
Vol 99 (6) ◽  
pp. 898-898 ◽  
Author(s):  
S. Zhang ◽  
D. Zhang ◽  
Y. Liu ◽  
J. Liu ◽  
Z. Zhao ◽  
...  
Keyword(s):  
Host Plant ◽  
Mosaic Virus ◽  
Capsicum Annuum ◽  
Natural Host ◽  
Chili Pepper ◽  
First Report ◽  
Dahlia Mosaic Virus

scholarly journals First Report of Tomato Leaf Curl Joydebpur Virus Infecting Chilli (Capsicum annuum) in Andaman and Nicobar Islands

Plant Disease ◽  
2019 ◽  
Vol 103 (11) ◽  
pp. 2974-2974
Author(s):  
N. Krishnan ◽  
S. Kumari ◽  
S. Krishnan ◽  
V. Dubey ◽  
A. K. Singh ◽  
...  
Keyword(s):  
Capsicum Annuum ◽  
Tomato Leaf ◽  
Andaman And Nicobar Islands ◽  
First Report ◽  
Nicobar Islands ◽  
Tomato Leaf Curl ◽  
Leaf Curl
Sign in / Sign up

Export Citation Format

Share Document