scholarly journals First Report of Pepper as a Natural Host for Pelargonium zonate spot virus in Spain

Plant Disease ◽  
2009 ◽  
Vol 93 (12) ◽  
pp. 1346-1346 ◽  
Author(s):  
F. Escriu ◽  
M. A. Cambra ◽  
M. Luis-Arteaga
Keyword(s):  
Indicator Species ◽  
The United States ◽  
Natural Host ◽  
Spot Virus ◽  
Tomato Plants ◽  
First Report ◽  
Systemic Symptoms ◽  
Line Patterns ◽  
Das Elisa ◽  
Pepper Plants

Pelargonium zonate spot virus (PZSV) was first reported on Pelargonium zonale (L.) L'Hér. ex Aiton and later on tomato in Italy, Spain, France (1), and the United States (2). In Spain, PZSV was first detected in 1996 in tomato plants of cv. Royesta from greenhouses in Zaragoza Province (3) and subsequently in tomato in the Catalonia and Navarra areas. In April 2006, symptoms of PZSV were found at high incidence on tomato in a greenhouse in Huesca, Aragón (northeastern Spain). Randomly distributed pepper plants (Capsicum annuum L.) of cv. Estilo F1 growing in the same greenhouse showed severe foliar chlorotic ringspots and line patterns similar to those observed in tomato. Samples from symptomatic peppers and tomatoes and one asymptomatic weed of Rubia tinctorum L. tested positive by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies against PZSV (Agdia Inc., Elkhart, IN and DSMZ, Braunschweig, Germany) as did a Spanish PZSV isolate used as a positive control (3). Sap extracts from two tomatoes, three peppers, and the single R. tinctorum plant were mechanically inoculated to 22 indicator species, including pepper and tomato. On 17 of 22 species inoculated, sap from symptomatic tomatoes and peppers elicited local or systemic symptoms similar to those reported earlier for PZSV isolates (3). Systemic symptoms were mainly mosaic, chlorotic, and necrotic line patterns and ringspots on leaves of most indicator species, closely resembling those observed on the greenhouse pepper and tomato plants. Symptoms on inoculated tomatoes also included stem necrosis and death. Reactions of indicator species did not indicate the presence of any other pepper- or tomato-infecting viruses. Both field infected and mechanically inoculated plants of pepper cvs. Yolo Wonder and Doux des Landes were maintained in the greenhouse until the development of fruit symptoms. Only fruits of cv. Yolo Wonder showed dark green and slightly depressed circles on their surface. Local and systemic infection by PZSV was confirmed by DAS-ELISA in most inoculated plants. Total RNA from leaves of field or inoculated plants was used as template for amplification by reverse transcription (RT)-PCR with primers R3-F and R3-R that are specific for the PZSV 3a gene (2), and amplicons were sequenced directly. The sequences of 697 nt from pepper and tomato isolates from the same greenhouse were identical (GenBank Accession Nos. CQ178217 and CQ178216, respectively) and had 96.1% identity to nucleotides 384 to 1,080 in PZSV RNA-3 (NC_003651). Our results confirm the natural infection of pepper plants in Huesca by PZSV. To our knowledge, this is the first report of pepper as a natural host for PZSV, a significant finding considering the potential risks of PZSV dispersion whenever tomato and pepper coexist, particularly in greenhouses and nurseries. References: (1) M. Finetti-Sialer and D. Gallitelli. J. Gen. Virol. 84:3143, 2003. (2) H. Y. Liu and J. L. Sears. Plant Dis. 91:633, 2007. (3) M. Luis-Arteaga and M. A. Cambra. Plant Dis. 84:807, 2000.

scholarly journals First Report of Pelargonium zonate spot virus from Tomato in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (5) ◽  
pp. 633-633 ◽  
Author(s):  
H.-Y. Liu ◽  
J. L. Sears
Keyword(s):  
United States ◽  
The United States ◽  
Rt Pcr ◽  
Spot Virus ◽  
Chenopodium Amaranticolor ◽  
Tomato Plants ◽  
First Report ◽  
Chenopodium Murale ◽  
Tomato Field ◽  
Infected Tomato

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

scholarly journals First Report of Onion (Allium cepa) Naturally Infected with Iris yellow spot virus in Peru

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 377-377 ◽  
Author(s):  
S. W. Mullis ◽  
R. D. Gitaitis ◽  
C. Nischwitz ◽  
A. S. Csinos ◽  
Z. C. Rafael Mallaupoma ◽  
...  
Keyword(s):  
The United States ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Enzyme Linked Immunosorbent Assay ◽  
Spot Virus ◽  
First Report ◽  
The Impact ◽  
Das Elisa

Onions have become an important export crop for Peru during the last few years. The onions produced for export are primarily short-day onions and include Grano- or Granex-type sweet onions. The first of two growing seasons for onion in Peru occurs from February/March until September/October and the second occurs from September/October to December/January. Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), primarily transmitted by onion thrips (Thrips tabaci), has been reported in many countries during recent years, including the United States (1,2). In South America, the virus was reported in Brazil during 1999 (3) and most recently in Chile during 2005 (4). During 2003, an investigation of necrotic lesions and dieback in onions grown near the towns of Supe and Ica, Peru led to the discovery of IYSV in this region. Of 25 samples of symptomatic plants collected from five different fields near Supe, 19 tested strongly positive and an additional three tested weakly positive for IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) (Agdia Inc., Elkhart, IN). None of the samples tested positive for Tomato spotted wilt virus (TSWV). A number of onions with necrosis and dieback symptoms were also observed during 2004 and 2005. During September 2005, 25 plants with symptoms suspected to be caused by IYSV or TSWV in the Supe and Casma valleys were collected and screened for both viruses using DAS-ELISA. All plants screened were positive for IYSV. There was no serological indication of TSWV infection in these samples. The positive samples were blotted onto FTA cards (Whatman Inc., U.K.) to bind the viral RNA for preservation and processed according to the manufacturer's protocols. The presence of IYSV was verified by reverse transcription-polymerase chain reaction (RTPCR) using (5′-TCAGAAATCGAGAAACTT-3′) and (5′-TAATTATATCTATCTTTCTTGG-3′) as forward and reverse primers (1), respectively. The primers amplify the nucleocapsid (N) gene of IYSV, and the RT-PCR products from this reaction were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose to verify the presence of this amplicon in the samples. Subsequent to the September 2005 sampling, 72 additional samples from regions in northern and southern Peru were analyzed in the same manner. The amplicons obtained were cloned, sequenced, and compared with known IYSV isolates for further verification. Onions have become a significant export crop for Peru, and more research is needed to determine the impact of IYSV on the Peruvian onion export crop. To our knowledge, this is the first report of IYSV in onion in Peru. References: (1) L. du Toit et al. Plant Dis. 88:222, 2004. (2) S. W. Mullis et al. Plant Dis. 88:1285, 2004. (3) L. Pozzer et al. Plant Dis. 83:345, 1999. (4) M. Rosales et al. Plant Dis. 89:1245, 2005.

scholarly journals First Report of Tomato spotted wilt virus and Impatiens necrotic spot virus in Slovenia

Plant Disease ◽  
2001 ◽  
Vol 85 (12) ◽  
pp. 1288-1288 ◽  
Author(s):  
I. Mavrič ◽  
M. Ravnikar
Keyword(s):  
Tomato Spotted Wilt Virus ◽  
Polyclonal Antiserum ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Tomato Spotted Wilt ◽  
Systemic Symptoms ◽  
Wilt Virus ◽  
Das Elisa

In July 2000, concentric necrotic rings and patterns were observed on greenhouse-grown pepper (Capsicum anuum L. ‘Blondi’). Symptoms were present only on lower leaves, not on young leaves or fruits. Typical tospovirus particles using electron microscopy were observed in leaf-dip preparations of symptomatic leaves. Impatiens necrotic spot virus (INSV) was detected in symptomatic but not in asymptomatic tissues using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with polyclonal antiserum (Loewe Biochemica, Sauerlach, Germany). Nicotiana benthamiana, N. rustica, and Petunia sp. were mechanically inoculated with sap of symptomatic leaves. Local and systemic symptoms were observed only on N. benthamiana. Tomato spotted wilt virus (TSWV) infections were later confirmed in some pepper and tomato plants with distinct systemic symptoms and in greenhouse-grown chrysanthemums, calla lilies, cyclamen and spatiphylum using DAS-ELISA with polyclonal antiserum. Severe systemic symptoms were observed only on some chrysanthemum cultivars, where the infection rate of TSWV was between 80 and 100%. Such TSWV-infected plants were not marketable. Symptomless infections by the same virus were also found. At one location, calla lilies were heavily infected by TSWV, but only local symptoms on leaves were observed. INSV was also confirmed using DAS-ELISA on different chrysanthemum cultivars. Mixed infections of TSWV and INSV were detected using DAS-ELISA on calla lilies with local necrotic rings and patterns on leaves and on Impatiens walerana with systemic necrosis. A limited number of weeds from the vicinity of greenhouses containing symptomatic plants were tested for the presence of TSWV using DAS-ELISA, and only Artemisia vulgaris was infected. Both viruses, TSWV from chrysanthemum and INSV from pepper, were isolated on test plants, and their identity was confirmed using DAS-ELISA. For further verification of TSWV and INSV infection, immunocapture reverse-transcription polymerase chain reaction was performed using general tospovirus primers (1). Amplification products of the expected size were detected and sequenced. Comparison of nucleic acid sequences of amplification products with viral sequence databases confirmed the identities of both viruses. To our knowledge, this is the first report of TSWV and INSV infection in ornamental and vegetable plants in Slovenia. Reference: (1) R. J. Weekes et al. Acta Hortic. 431:159, 1996.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 762-762 ◽  
Author(s):  
R. K. Sampangi ◽  
C. Almeyda ◽  
K. L. Druffel ◽  
S. Krishna Mohan ◽  
C. C. Shock ◽  
...  
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Great Basin ◽  
Natural Infection ◽  
The United States ◽  
Native Plant ◽  
Rt Pcr ◽  
Cmv Infection ◽  
Spot Virus ◽  
First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

scholarly journals First Report of Iris yellow spot virus on Onion and Leek in Western Oregon

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 468-468 ◽  
Author(s):  
D. H. Gent ◽  
R. R. Martin ◽  
C. M. Ocamb
Keyword(s):  
United States ◽  
Disease Incidence ◽  
The United States ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Spot Virus ◽  
First Report ◽  
Seed Crop ◽  
Onion Seed ◽  
Seed Crops

Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.

scholarly journals First Report of Tomato chlorosis virus Infecting Sweet Pepper in Costa Rica

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1482-1482 ◽  
Author(s):  
J. A. Vargas ◽  
E. Hernández ◽  
N. Barboza ◽  
F. Mora ◽  
P. Ramírez
Keyword(s):  
Costa Rica ◽  
The United States ◽  
Sweet Pepper ◽  
Nutritional Deficiencies ◽  
Total Rna ◽  
First Report ◽  
Leaf Curling ◽  
Pcr Products ◽  
Tomato Chlorosis Virus ◽  
Pepper Plants

In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in 11 pepper-growing greenhouses in the province of Cartago, Costa Rica. During this survey, the vast majority of sweet pepper (Capsicum annuum cv. Nataly) plants showed interveinal chlorosis, enations, necrosis, and mild upward leaf curling. Large populations of whiteflies were present and they were found to be composed only of Trialeurodes vaporariorum. Total RNA from frozen plant samples was extracted with TRI Reagent (Molecular Research Inc., Cincinnati, OH). RevertAid H Minus Reverse Transcriptase Kit (Fermentas, Hanover, MD) was used for reverse transcription of the total RNA extract, with cDNA synthesis directed using random primers. A real-time PCR assay was performed to detect Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Three sets of primers were used to confirm the presence of ToCV in the samples: TocQ875F/TocQ998R primer set directed to a fragment of 123 bp of the HSP gene (3); ToCVp22RQF (5′-TGGATCTCACTGGTTGCTTG-3′)-ToCVp22RQR (5′-TAGTGTTTCAGCGCCAACAG-3′) primer pair that amplifies a 198-bp segment of the ToCV p22 gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora, and P. Ramirez, unpublished) and the ToCVCPmRQF (5′-CATTGGTTGGGGATTACGTC-3′)-ToCVCPmRQR (5′-TCTCAGCCTTGACTTGAGCA-3′) primer pair designed to amplify a 170-bp portion of the ToCV CPm gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora and P. Ramirez, unpublished). Fifteen symptomatic samples per greenhouse were tested for a total of 165 sweet pepper plants. From this total, seven samples from four different greenhouses produced amplification of PCR products with all three sets of primers. One of the seven samples showed mild chlorosis, but others were highly chlorotic with different levels of upward leaf curling. None of the other samples showed amplification with any of the primer sets; the symptoms on these plants could have been due to nutritional deficiencies or infection by viruses. Sequence analysis of the 460-bp HSP PCR products, produced using previously reported primers (3), and 150-bp fragment of the P22 revealed 100% sequence identity with a tomato isolate of ToCV from the United States (GenBank Accession No. AY903448). Because of the low number of samples infected with ToCV and the high incidence of symptoms, DNA extraction and a begomovirus PCR detection assay was performed using primer pair AV494/AC1048 (4). Negative results were obtained for all samples. To our knowledge, this is the first report of ToCV infecting sweet pepper plants in Costa Rica and the third one worldwide. ToCV has also been found to be infecting tomato in open field and greenhouses (1) and other weeds in greenhouses including Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolaccaceae), Plantago major (Plantaginaceae), and Brassica sp. (Brassicaceae) (2) in the same region of Costa Rica, suggesting that it has adapted to the conditions of the area and poses an important threat to the vegetable production. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) A. Solorzano-Morales et al. Plant Dis. 95:497, 2011. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008. (4) S. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of Iris yellow spot virus on Garlic in India

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1066-1066 ◽  
Author(s):  
S. J. Gawande ◽  
A. Khar ◽  
K. E. Lawande
Keyword(s):  
Natural Infection ◽  
The United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
First Report ◽  
Qiagen Gmbh ◽  
The World ◽  
Seed Crops

Garlic (Allium sativum) is a spice crop of prime importance in India as well as other parts of the world. Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an important pathogen of onion bulb and seed crops in many parts of the world (3). The virus is also known to infect garlic and other Allium spp. (2–4). IYSV infection of garlic was reported from Reunion Island (4) and the United States (1). In February 2010, straw-colored, spindle-shaped spots with poorly defined ends were observed on the leaves of a garlic crop at the research farm of the Directorate of Onion and Garlic Research in the Pune District of Maharashtra State, India, 105 days after planting. The spots coalesced to form larger patches on the leaves, suggesting possible IYSV infection. Symptoms were visible on older leaves and more prevalent on cv. G-41, G-282, AC50, AC200, AC283, and Godavari than on other cultivars. The incidence of symptomatic plants was estimated at 5% for G-41 and AC-200, 8% for G-282 and AC283, and 10% for AC50. Leaves were sampled from 40 symptomatic plants per cultivar with each sample composited from young, middle, and older (basal) leaves of the plant. Samples were assayed by double-antibody sandwich-ELISA (Loewe Biochemica GmbH, Sauerlach, Germany) and each tested positive for the virus. Total RNA was extracted from the leaves of ELISA-positive plants using the RNAeasy Plant Mini kit (Qiagen GmbH, Hilden, Germany) and tested by reverse transcription-PCR assay using primers IYSV-F (5′-TCAGAAATCGAGAAACTT-3′) and IYSV-R (5′-TAATTATATCTATCTTTCTTGG-3′) (2) designed to amplify 797 bp of the nucleocapsid (N) gene of IYSV. Amplicons of expected size were obtained and cloned into a pDrive vector (Qiagen GmbH). The recombinant clone was sequenced (GenBank Accession No. HM173691). Sequence comparisons showed 98 to 100% nt identity with other IYSV N gene sequences in GenBank (Nos. EU310294 and EU310286). A phylogenetic analysis of the deduced amino acid sequences of the N gene showed that the garlic isolate of IYSV grouped most closely with onion IYSV isolates from India (GenBank Nos. EU310294, EU310286, EU310300, and EU310296). To our knowledge, this is the first report of natural infection of garlic by IYSV in India. Additional surveys and evaluations are needed to obtain a better understanding of the potential impact of IYSV on garlic production in India. References: (1) S. Bag et al. Plant Dis. 93:839, 2009. (2) A. Bulajic et al. Plant Dis. 93:976, 2009. (3) D. Gent et al. Plant Dis. 90:1468, 2006. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

Sign in / Sign up

Export Citation Format

Share Document