A point-of-care diagnostic for differentiating Ebola from endemic febrile diseases

2018 ◽  
Vol 10 (471) ◽  
pp. eaat0944 ◽  
Author(s):  
David Sebba ◽  
Alexander G. Lastovich ◽  
Melody Kuroda ◽  
Eric Fallows ◽  
Joshua Johnson ◽  
...  

Hemorrhagic fever outbreaks such as Ebola are difficult to detect and control because of the lack of low-cost, easily deployable diagnostics and because initial clinical symptoms mimic other endemic diseases such as malaria. Current molecular diagnostic methods such as polymerase chain reaction require trained personnel and laboratory infrastructure, hindering diagnostics at the point of need. Although rapid tests such as lateral flow can be broadly deployed, they are typically not well-suited for differentiating among multiple diseases presenting with similar symptoms. Early detection and control of Ebola outbreaks require simple, easy-to-use assays that can detect and differentiate infection with Ebola virus from other more common febrile diseases. Here, we developed and tested an immunoassay technology that uses surface-enhanced Raman scattering (SERS) tags to simultaneously detect antigens from Ebola, Lassa, and malaria within a single blood sample. Results are provided in <30 min for individual or batched samples. Using 190 clinical samples collected from the 2014 West African Ebola outbreak, along with 163 malaria positives and 233 negative controls, we demonstrated Ebola detection with 90.0% sensitivity and 97.9% specificity and malaria detection with 100.0% sensitivity and 99.6% specificity. These results, along with corresponding live virus and nonhuman primate testing of an Ebola, Lassa, and malaria 3-plex assay, indicate the potential of the SERS technology as an important tool for outbreak detection and clinical triage in low-resource settings.

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tahmineh Jalali ◽  
Mostafa Salehi-Vaziri ◽  
Mohammad Hassan Pouriayevali ◽  
Seyed Latif Mousavi Gargari

AbstractCrimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.


Diagnostics ◽  
2021 ◽  
Vol 11 (11) ◽  
pp. 1950
Author(s):  
Woong Sik Jang ◽  
Da Hye Lim ◽  
YoungLan Choe ◽  
Hyunseul Jee ◽  
Kyung Chul Moon ◽  
...  

Malaria, caused by the parasite Plasmodium and transmitted by mosquitoes, is an epidemic that mainly occurs in tropical and subtropical regions. As treatments differ across species of malarial parasites, there is a need to develop rapid diagnostic methods to differentiate malarial species. Herein, we developed a multiplex malaria Pan/Pf/Pv/actin beta loop-mediated isothermal amplification (LAMP) to diagnose Plasmodium spp., P. falciparum, and P. vivax, as well as the internal control (IC), within 40 min. The detection limits of the multiplex malaria Pan/Pf/Pv/IC LAMP were 1 × 102, 1 × 102, 1 × 102, and 1 × 103 copies/µL for four vectors, including the 18S rRNA gene (Plasmodium spp.), lactate dehydrogenase gene (P. falciparum), 16S rRNA gene (P. vivax), and human actin beta gene (IC), respectively. The performance of the LAMP assay was compared and evaluated by evaluating 208 clinical samples (118 positive and 90 negative samples) with the commercial RealStar® Malaria S&T PCR Kit 1.0. The developed multiplex malaria Pan/Pf/Pv/IC LAMP assay showed comparable sensitivity (100%) and specificity (100%) with the commercial RealStar® Malaria S&T PCR Kit 1.0 (100%). These results suggest that the multiplex malaria Pan/Pf/Pv/IC LAMP could be used as a point-of-care molecular diagnostic test for malaria.


Biomedika ◽  
2020 ◽  
Vol 13 (1) ◽  
pp. 23-30
Author(s):  
Mustika Sari Hutabarat ◽  
Firdaus Hamid ◽  
Irawaty Djaharuddin ◽  
Alfian Zainuddin ◽  
Rossana Agus ◽  
...  

Streptococcus pneumoniae (pneumococcus) is a Gram-positive facultative anaerobic bacterium that is a major cause of morbidity and mortality worldwide. But the lack of reporting of disease by this bacterium in Indonesia, one of the causes is because the diagnosis of pneumococcal infection is often clinically not typical and conventional methods which are still the standard gold method often give false-negative results. So the purpose of this study was to evaluate the performance of culture and molecular diagnostic methods using the Polymerase Chain Reaction (PCR) technique in detecting Streptococcus pneumoniae in sputum clinical samples using the Autolysin (LytA) gene which is a virulence factor of this bacterium. 57 isolates from 60 samples were confirmed as Streptococcus sp through microscopic identification, culture, and biochemical tests. Then the sensitivity test with an optochin test of 9 (9%) compared the results descriptively with the PCR technique using the Autolysin A (LytA) gene which was obtained more sensitive by 15 (25%).


2017 ◽  
Vol 2017 ◽  
pp. 1-5 ◽  
Author(s):  
Akouda Akessiwe Patassi ◽  
Dadja Essoya Landoh ◽  
Agballa Mebiny-Essoh Tchalla ◽  
Wemboo Afiwa Halatoko ◽  
Hamadi Assane ◽  
...  

Background. Lassa fever belongs to the group of potentially fatal hemorrhagic fevers, never reported in Togo. The aim of this paper is to report the first two cases of Lassa fever infection in Togo. Case Presentation. The two first Lassa fever cases occurred in two expatriate’s health professionals working in Togo for more than two years. The symptoms appeared among two health professionals of a clinic located in Oti district in the north of the country. The absence of clinical improvement after antimalarial treatment and the worsening of clinical symptoms led to the medical evacuation. The delayed diagnosis of the first case led to a fatal outcome. The second case recovered under ribavirin treatment. Conclusion. The emergence of this hemorrhagic fever confirms the existence of Lassa fever virus in Togo. After a period of intensive Ebola virus transmission from 2013 to 2015, this is an additional call for the establishment and enhancement of infection prevention and control measures in the health care setting in West Africa.


2019 ◽  
Vol 1 (3) ◽  
pp. 105-116
Author(s):  
A. O. Sementsova ◽  
V. G. Dedkov ◽  
V. A. Ternovoy ◽  
E. V. Chub ◽  
S. A. Pyankov ◽  
...  

Ebola virus disease is dangerous viral infection, occurring in the form of hemorrhagic fever, characterized by acute clinical symptoms and high mortality rate due to multiple organ failure. Ebola virus natural foci are located in forested areas of the central and western parts of Africa. It was believed for many years, the incidence of Ebola virus disease has been sporadic and the burden of it is true only in endemic areas. However, the unprecedented Ebola epidemic caused by Zaire virus in 2013 — 2016, has significantly changed our understanding of this disease and the patterns of its distribution. We have also identified weaknesses in the organization of anti-epidemic measures, the effectiveness of which was not very effective at the onset of the epidemic, in particular due to weak development of in vitro diagnostics (IVD). However, during the elimination of the epidemic in West Africa, anti-epidemic system has been modified substantially, largely due to quickly developed IVD kits. This review is devoted to analysis of trends in IVD for Ebola virus disease based on the experience obtained in the course of the West-African epidemic in 2013 — 2016.


2020 ◽  
pp. 1-23
Author(s):  
Abhishek Padhi ◽  
Ekta Gupta ◽  
Gaurav Singh ◽  
Reshu Agarwal ◽  
Manoj Kumar Sharma ◽  
...  

Lab on a Chip ◽  
2016 ◽  
Vol 16 (4) ◽  
pp. 753-763 ◽  
Author(s):  
Natalia M. Rodriguez ◽  
Winnie S. Wong ◽  
Lena Liu ◽  
Rajan Dewar ◽  
Catherine M. Klapperich

We present a low-cost, disposable, and fully-integrated paperfluidic molecular diagnostic chip for sample-to-result functionality at the point-of-care.


2016 ◽  
Vol 214 (suppl 3) ◽  
pp. S234-S242 ◽  
Author(s):  
Jason W. Benzine ◽  
Kerry M. Brown ◽  
Krystle N. Agans ◽  
Ronald Godiska ◽  
Chad E. Mire ◽  
...  

2015 ◽  
Vol 9 (05) ◽  
pp. 441-455 ◽  
Author(s):  
Kuldeep Dhama ◽  
Yashpal Singh Malik ◽  
Satya Veer Singh Malik ◽  
Raj Kumar Singh

Humans constantly encounter threats from many infectious, zoonotic, and devastating pathogens. Outbreaks of severe acute respiratory syndrome (SARS), bird flu, and swine flu posing pandemic threats have compelled health agencies to follow global preparedness for combating the emerging deadly pathogens. The outbreak in West Africa of highly contagious Ebola viral disease (EVD) that started in Guinea in December 2013, assumed global proportions to become the largest outbreak of EVD and the most prominent international health concern. With fatality rates of nearly 50%–90%, it has claimed, as of 11 April 2015, 10,619 human lives out of a total of 25,626 cases reported worldwide. Ebola virus (EBOV), a member of Filoviridae family, is associated with severe, often lethal, hemorrhagic fever disease in humans and animals. The animal hosts, including non-human primates and reservoir hosts (fruit bats), play a significant role in transmission and maintenance of EBOV in nature. Although no approved vaccine for the prevention of EVD currently exists, disease control can be greatly enhanced by timely laboratory confirmation through blood tests using enzyme-linked immunosorbent assay (ELISA) and reverse transcription polymerase chain reaction (RT-PCR). Adherence to strict sanitary and hygienic measures, monitoring and surveillance of EBOV, as well as quarantine checks on international trade, transport, and visitors from affected countries are mandatory to prevent and control the spread of EVD. This review describes the salient properties of EBOV and the development of novel diagnostics, vaccines, and control strategies for this emerging disease of high public health concern and international emergency.


2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Geoffri Ricci ◽  
Kevin Minsker ◽  
Austin Kapish ◽  
James Osborn ◽  
Sha Ha ◽  
...  

AbstractDirect at line monitoring of live virus particles in commercial manufacturing of vaccines is challenging due to their small size. Detection of malformed or damaged virions with reduced potency is rate-limited by release potency assays with long turnaround times. Thus, preempting batch failures caused by out of specification potency results is almost impossible. Much needed are in-process tools that can monitor and detect compromised viral particles in live-virus vaccines (LVVs) manufacturing based on changes in their biophysical properties to provide timely measures to rectify process stresses leading to such damage. Using ERVEBO, MSD’s Ebola virus vaccine as an example, here we describe a flow virometry assay that can quickly detect damaged virus particles and provide mechanistic insight into process parameters contributing to the damage. Furthermore, we describe a 24-h high throughput infectivity assay that can be used to correlate damaged particles directly to loss in viral infectivity (potency) in-process. Collectively, we provide a set of innovative tools to enable rapid process development, process monitoring, and control strategy implementation in large scale LVV manufacturing.


Sign in / Sign up

Export Citation Format

Share Document