scholarly journals PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.

1994 â—½  
Vol 32 (2) â—½  
pp. 335-351 â—½  
Author(s):  
K Greisen â—½  
M Loeffelholz â—½  
A Purohit â—½  
D Leong
Keyword(s):  
Cerebrospinal Fluid â—½  
16S Rrna â—½  
16S Rrna Gene â—½  
Pathogenic Bacteria â—½  
Pcr Primers â—½  
Rrna Gene â—½  
The 16S Rrna Gene

PCR primers targeting the 16S rRNA gene for the specific detection of streptomycetes

2001 â—½  
Vol 15 (6) â—½  
pp. 337-347 â—½  
Author(s):  
H. Rintala â—½  
A. Nevalainen â—½  
E. Rönkä â—½  
M. Suutari
Keyword(s):  
16S Rrna â—½  
16S Rrna Gene â—½  
Pcr Primers â—½  
Rrna Gene â—½  
Specific Detection â—½  
The 16S Rrna Gene

scholarly journals Genetic characterization of the microbiota of artisan fresh cheese from the Papaloapan region

2021 â—½  
Vol 6 (2) â—½  
pp. 61-85
Author(s):  
Miguel A. García-Muñoz â—½  
â—½  
Nancy Cruz-Velazco â—½  
América Chávez-Martínez â—½  
Cirilo Nolasco-Hipólito â—½  
...  
Keyword(s):  
16S Rrna â—½  
16S Rrna Gene â—½  
Gel Electrophoresis â—½  
Pathogenic Bacteria â—½  
Denaturing Gradient Gel Electrophoresis â—½  
Starter Cultures â—½  
Rrna Gene â—½  
Gradient Gel Electrophoresis â—½  
Fresh Cheese â—½  
The 16S Rrna Gene

The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) The population of the Papaloapan region consume artisan fresh cheeses and no pathogen outbreaks have been reported recently. The microbiota is responsible to develop desirable characteristics of cheeses and undesirable characteristics due to the presence of certain pathogens microorganisms. Therefore, to identify the microorganisms of fresh cheeses is an important issue for the producers, consumers, and authorities. 11 Artisan fresh cheese samples from the Papaloapan region were collected in the summer and 11 samples in winter to characterize their microbiota. Traditional microbial techniques were used to identify the fungus and the amplification of the 16S rRNA gene and PCR-denaturing gradient gel electrophoresis (DGGE) method was used for bacteria identification. For all the samples, the presence of aerobic mesophiles, Streptococcus mesophiles and thermophiles, Lactobacillus mesophiles, Leuconostoc, total coliforms, Staphylococcus aureus, molds, and yeasts were identified. The complexity and variety of microorganisms in the summer and winter seasons samples were not significantly different. In conclusion, all samples of fresh artisan cheeses were under high microbial loads. Lactic Acid Bacteria (LAB) were in a typical load, as established by the quality and safety standards in the food industry. Conversely, pathogenic bacteria exceeded this limit. The microorganisms present in the fresh artisanal cheeses of the Papaloapan region were identified with precision, regarding the count and their diversity. A recommendation for the cheese manufacturers is to prepare starter cultures by selecting the appropriate microorganisms to produce the desirable characteristics such as aroma and flavor and reduce the risk of microbial infections by using pasteurized milk.

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease â—½  
2013 â—½  
Vol 97 (10) â—½  
pp. 1375-1375 â—½  
Author(s):  
B. Dutta â—½  
R. D. Gitaitis â—½  
F. H. Sanders â—½  
C. Booth â—½  
S. Smith â—½  
...  
Keyword(s):  
16S Rrna â—½  
16S Rrna Gene â—½  
Leaf Spot â—½  
Pathogenic Bacteria â—½  
Bacterial Suspension â—½  
Rrna Gene â—½  
Bacterial Isolates â—½  
Pcr Assay â—½  
First Report â—½  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Specific and effective detection of anammox bacteria using PCR primers targeting the 16S rRNA gene and functional genes

2020 â—½  
Vol 734 â—½  
pp. 139387 â—½  
Author(s):  
Yuchun Yang â—½  
Meng Li â—½  
Hui Li â—½  
Xiao-Yan Li â—½  
Jih-Gaw Lin â—½  
...  
Keyword(s):  
16S Rrna â—½  
16S Rrna Gene â—½  
Pcr Primers â—½  
Functional Genes â—½  
Anammox Bacteria â—½  
Rrna Gene â—½  
The 16S Rrna Gene

scholarly journals Cultivable bacterial diversity of the canine dental plaque as a potential source of bacterial infections

2021 â—½  
Vol 90 (2) â—½  
pp. 171-178
Author(s):  
Marián Maďar â—½  
Jana Kačírová â—½  
Aladár Maďari â—½  
Rastislav Mucha â—½  
Eva Styková â—½  
...  
Keyword(s):  
16S Rrna â—½  
16S Rrna Gene â—½  
Dental Plaque â—½  
Pathogenic Bacteria â—½  
Companion Animals â—½  
Oral Bacteria â—½  
Universal Primers â—½  
Rrna Gene â—½  
Persistent Problem â—½  
The 16S Rrna Gene

Dental diseases are a persistent problem, not only in humans, but very often in companion animals as well. Aetiological agents of these diseases are the dental plaque bacteria. In the present study, we focused on identifying cultivable bacteria living in the dental plaque of dogs, specifically dogs suffering from the early stages of periodontal disease. Canine oral bacteria pose a risk to humans that get bitten by the dog, but they also have a zoonotic potential. Dental plaque samples were taken from five dogs of small breeds. Samples were cultured under aerobic and anaerobic conditions on several types of microbiological agars. All obtained and selected bacterial colonies were identified by PCR with universal primers for the 16S rRNA gene and the sequences of the 16S rRNA gene were compared with the sequences available in the GenBank database using BLASTn analysis. A total of 75 bacteria belonging to five phyla, predominantly to Firmicutes and Proteobacteria, were identified. The most frequent species was Pasteurella canis which was detected in all samples. In addition, representatives of the genera Actinomyces, Bacillus, Bacteroides, Corynebacterium, Frederiksenia, Fusobacterium, Haemophilus, Lactobacillus, Leucobacter, Neisseria, Ottowia, Porphyromonas, Pseudomonas, Staphylococcus, Stenotrophomonas and Streptococcus were detected in the samples. In the present study, a broad spectrum of bacteria in dental plaque samples, including canine periodontal pathogens such as Porphyromonas gulae or Porphyromonas macacae were identified. In addition, highly pathogenic bacteria, specifically Actinomyces hordeovulneris, Bacillus circulans, and Bacteroides pyogenes, which pose a serious risk to human health, were detected in samples.

scholarly journals Identification of Opportunistic Pathogenic Bacteria in Drinking Water Samples of Different Rural Health Centers and Their Clinical Impacts on Humans

10.1155/2013/348250 â—½  
2013 â—½  
Vol 2013 â—½  
pp. 1-10 â—½  
Author(s):  
Pavan Kumar Pindi â—½  
P. Raghuveer Yadav â—½  
A. Shiva Shanker
Keyword(s):  
Drinking Water â—½  
16S Rrna â—½  
16S Rrna Gene â—½  
Water Samples â—½  
Pathogenic Bacteria â—½  
Gene Sequence â—½  
16S Rrna Gene Sequence â—½  
Rrna Gene â—½  
Rrna Gene Sequence â—½  
The 16S Rrna Gene

International drinking water quality monitoring programs have been established in order to prevent or to reduce the risk of contracting water-related infections. A survey was performed on groundwater-derived drinking water from 13 different hospitals in the Mahabubnagar District. A total of 55 bacterial strains were isolated which belonged to both gram-positive and gram-negative bacteria. All the taxa were identified based on the 16S rRNA gene sequence analysis based on which they are phylogenetically close to 27 different taxa. Many of the strains are closely related to their phylogenetic neighbors and exhibit from 98.4 to 100% sequence similarity at the 16S rRNA gene sequence level. The most common group was similar toAcinetobacter junii(21.8%) andAcinetobacter calcoaceticus(10.9%) which were shared by 7 and 5 water samples, respectively. Out of 55 isolates, only 3 isolates belonged to coliform group which areCitrobacter freundiiandPantoea anthophila. More than half (52.7%, 29 strains) of the phylogenetic neighbors which belonged to 12 groups were reported to be pathogenic and isolated from clinical specimens. Out of 27 representative taxa are affiliated have eight representative genera in drinking water except for those affiliated with the generaExiguobacterium, Delftia, Kocuria,andLysinibacillus.

scholarly journals Gram Type-Specific Broad-Range PCR Amplification for Rapid Detection of 62 Pathogenic Bacteria

1999 â—½  
Vol 37 (2) â—½  
pp. 464-466 â—½  
Author(s):  
Alfred Klausegger â—½  
Markus Hell â—½  
Alexandra Berger â—½  
Kerstin Zinober â—½  
Sabine Baier â—½  
...  
Keyword(s):  
16S Rrna â—½  
Rapid Detection â—½  
Pathogenic Bacteria â—½  
Pcr Amplification â—½  
Pcr Primers â—½  
Rrna Gene â—½  
Gram Negative Bacteria â—½  
Pathogenic Species â—½  
Gram Negative â—½  
The 16S Rrna Gene

Broad-range PCR has proven to be useful for the detection of bacteria. A set of broad-range PCR primers directed against conserved regions in the 16S rRNA gene was designed to specifically amplify either gram-positive or gram-negative bacteria. The gram type-specific broad-range PCR correctly classified all 62 pathogenic species tested.

scholarly journals Phylogenetic analysis of Helicobacter species based on partial gyrB gene sequences

2007 â—½  
Vol 57 (3) â—½  
pp. 444-449 â—½  
Author(s):  
Minna Hannula â—½  
Marja-Liisa Hänninen
Keyword(s):  
Phylogenetic Analysis â—½  
16S Rrna â—½  
16S Rrna Gene â—½  
Pcr Primers â—½  
Phylogenetic Study â—½  
Rrna Gene â—½  
Gene Sequences â—½  
Specific Pcr â—½  
Species Specific â—½  
The 16S Rrna Gene

Analysis of 16S rRNA gene sequences is one of the most common methods for investigating the phylogeny and taxonomy of bacteria. However, several studies have indicated that the 16S rRNA gene does not distinguish between certain Helicobacter species. We therefore selected for phylogenetic analysis an alternative marker, gyrB, encoding gyrase subunit B. The aim of this investigation was to examine the applicability of gyrB gene fragments (~1100 bp) for the phylogenetic study of 16 Helicobacter species and a total of 33 Helicobacter strains included in this study. Based on the sequenced fragments, a phylogenetic tree was obtained that contained two distinct clusters, with gastric species forming one cluster and enterohepatic species the other. The only exception was the gastric species Helicobacter mustelae, which clustered with the enterohepatic species. The calculated similarity matrix revealed the highest interspecies similarity between Helicobacter salomonis and Helicobacter felis (89 %) and the lowest similarity between Helicobacter pullorum and H. felis (60 %). The DNA G+C content of the sequenced fragments was ⩽40 mol% in enterohepatic species and >46 mol% in gastric species, excluding Helicobacter pylori and H. mustelae, with G+C contents of 34 and 42 mol%, respectively. In summary, the gyrB gene fragments provided superior resolution and reliability to the 16S rRNA gene for differentiating between closely related Helicobacter species. A further outcome of this study was achieved by designing gyrB gene-based species-specific PCR primers for the identification of Helicobacter bizzozeronii.

scholarly journals A New Report of Xanthomonas cucurbitae Causing Bacterial Leaf Spot of Watermelon in Georgia, USA

Plant Disease â—½  
2013 â—½  
Vol 97 (4) â—½  
pp. 556-556 â—½  
Author(s):  
B. Dutta â—½  
R. D. Gitaitis â—½  
K. J. Lewis â—½  
D. B. Langston
Keyword(s):  
16S Rrna â—½  
16S Rrna Gene â—½  
Xanthomonas Campestris â—½  
Pathogenic Bacteria â—½  
Substrate Utilization â—½  
Rrna Gene â—½  
Conventional Pcr â—½  
Specific Primers â—½  
Necrotic Spots â—½  
The 16S Rrna Gene

In June 2012, watermelon leaves (Citrullus lanatus (Thunb.) Matsum. & Nakai) were observed with angular, necrotic spots with chlorotic halos in a field in Telfair County, GA. The field exhibited 20 to 25% disease incidence with no observable symptoms on fruits. Isolations were made from foliar lesions of 30 leaves onto yeast extract-dextrose–CaCO3 (YDC) agar medium (3). Yellow-pigmented, Xanthomonas-like colonies were observed after 48-h incubation at 28°C from 100% of the samples. Bacteria harvested were gram-negative, oxidase-negative, indole-negative, hydrolyzed starch and esculin, and formed pits on crystal violet pectate and carboxymethyl cellulose media. The bacterial isolates did not produce nitrites from nitrates but produced hypersensitive reactions on tobacco upon inoculation with 1 × 108 colony-forming units (CFU)/ml. These characteristics are typical of members of the Xanthomonas campestris group. The genus Xanthomonas was confirmed using conventional PCR with genus-specific primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′), which produced an 840-bp band. Universal primers fD1 and rD1 (1) were used to amplify the 16S rRNA gene from four isolates and amplified products were sequenced and BLAST searched in GenBank. The nucleotide sequences of the isolates showed 97 to 98% similarity to X. cucurbitae (Accessions AB680438.1 and Y10760), X. campestris (HQ256868.1), X. arboricola (JF835910.1), X. oryzae pv. oryzicola (CP003057.1) and X. campestris pv. raphani (CP002789.1). PCR amplification and sequencing of the atpD gene (ATP synthase, 720 bp) showed 99% similarity with X. cucurbitae when BLAST searched in GenBank (HM568911.1). X. cucurbitae was not present in the database of BIOLOG (Biolog, Hayward, CA); therefore, substrate utilization tests of three isolates were compared with substrate utilization patterns of Xanthomonas groups reported by Vauterin et al. (4). The watermelon isolates displayed 93.7, 89.5, and 89.5% similarity with the reported BIOLOG metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, none of the isolates were amplified using a conventional PCR assay with X. campestris pv. campestris and X. campestris pv. raphani-specific primers (2), indicating a closer relationship with X. cucurbitae. When 2-week old watermelon seedlings cv. Crimson sweet (n = 4/isolate/experiment) were inoculated by spraying with a suspension of 1 × 108 CFU/ml, 100% of the seedlings developed symptoms (water soaked angular lesions that developed into necrotic spots) 14 days after planting under greenhouse conditions (~30°C and ~70% RH). Ten control plants inoculated with sterile water remained asymptomatic. Bacterial colonies were reisolated from symptomatic seedlings that showed similar characteristics to those described above. The identity of isolated colonies was confirmed by amplifying and sequencing the 16S rRNA gene, which showed 97 to 98% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on watermelon in Georgia since the 1950s. References: (1) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (2) Leu et al. Plant Pathol. Bull. 19:137, 2010. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria, 3rd ed. APS Press. St. Paul, MN, 2001. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

Sign in / Sign up

Export Citation Format

Share Document