Molecular evidence of Ehrlichia canis and Anaplasma platys and the association of infections with hematological responses in naturally infected dogs in Kalasin, Thailand

Background: Tick-borne bacteria, Anaplasma platys and Ehrlichia canis are well recognized as the etiology of anemia and thrombocytopenia in dogs. The clinical signs of anaplasmosis and ehrlichiosis range from asymptomatic to severe symptoms. There are insufficient studies about epidemiological surveys of these blood parasites, also the association of infections with the hematological study. Aim: This study aimed to screen A. platys and E. canis in naturally infected dogs and the effects of the infection on the levels of packed cell volume (PCV) and platelet count. Materials and Methods: A total of 68 blood samples were collected from free-roaming dogs at Nong Kung Sri district, Kalasin Province, Thailand, and examined for A. platys and E. canis infection by polymerase chain reaction (PCR) and measured PCV levels and platelet count. Results: Using nested PCR, 42.65% of dogs were infected with one or two pathogens. The molecular detection of anaplasmosis and ehrlichiosis in this population was 29.4% (95% confidence interval [CI]: 18.98-41.71) and 25% (95% CI: 14.4-35.3), respectively. Coinfection occurred at 11.8% (95% CI: 5.22-21.87). Infection with E. canis and coinfection showed significant association with PCV levels (p<0.05) while A. platys infection showed no statistical relationship. Infection with A. platys, E. canis, and coinfection had a non-significant correlation with platelet count (p>0.05). Conclusion: This study provides data of anaplasmosis and ehrlichiosis in free-roaming dogs which indicated that these zoonotic diseases are widespread and require for disease frequency determination, especially in Kalasin Province of Thailand where data of tick-borne infections in dogs have not been reported.

Download Full-text

First Molecular Evidence of Pathogens in Fleas Collected from Dogs in Northern Vietnam

Pathogens ◽

10.3390/pathogens10091185 ◽

2021 ◽

Vol 10 (9) ◽

pp. 1185

Author(s):

Thom Do ◽

Tawin Inpankaew ◽

Duc Hieu Duong ◽

Khanh Linh Bui

Keyword(s):

Molecular Detection ◽

Zoonotic Diseases ◽

Domestic Dogs ◽

Molecular Evidence ◽

International Literature ◽

Risk Of Infection ◽

Rickettsia Felis ◽

Northern Vietnam ◽

Mycoplasma Wenyonii ◽

Wide Range

Fleas are considered as hosts for a wide range of pathogens that cause emerging and re-emerging zoonotic diseases worldwide. Data on fleas and flea-borne pathogens (FBPs) in the international literature are limited in Vietnam. This study aimed to investigate the species of fleas and the presence of pathogens of interest in fleas in northern Vietnam using PCR and sequence analysis. Out of 200 dogs enrolled in this study, 20% were infested by the flea species Ctenocephalides felis felis. In total, 62 fleas (35 females and 27 males) collected from domestic dogs were molecularly screened for the detection of pathogens. Out of the screened fleas, 39 were positive for Rickettsia felis (62.9%), 9 for Candidatus Mycoplasma hemobos (14.52%), and 6 for Mycoplasma wenyonii (9.68%). This study shows the first molecular detection of the above-mentioned pathogens in fleas collected from the studied areas and the potential risk of infection with examined FBPs in northern Vietnam.

Download Full-text

Molecular detection of visceral leishmaniasis in dogs from Barão de Melgaço, Pantanal region of Mato Grosso, Brazil

Pesquisa Veterinária Brasileira ◽

10.1590/1678-5150-pvb-6485 ◽

2021 ◽

Vol 41 ◽

Author(s):

Álvaro Felipe L.R. Dias ◽

Arleana B.P.F. Almeida ◽

Luciano Nakazato ◽

Valéria R.F. Sousa

Keyword(s):

Visceral Leishmaniasis ◽

Molecular Detection ◽

Clinical Signs ◽

Conventional Polymerase Chain Reaction ◽

Epidemiological Survey ◽

Mato Grosso ◽

Canine Infection ◽

Polymerase Chain ◽

Comparison Of The Results ◽

Low Prevalence

ABSTRACT: The increasing expansion of visceral leishmaniasis (VL) in the Brazilian territory evidences the need for studies focused on the main reservoir of this parasite: the dog. This study aimed to conduct an epidemiological survey in the municipality of Barão de Melgaço, Pantanal region of the state of Mato Grosso (MT), Brazil. Conventional polymerase chain reaction (PCR) and qualitative SYBR®Green real-time PCR (qPCR) were used to diagnose canine VL (CVL) and characterize the factors associated with this infection. Of the 402 dogs that had blood samples collected, 31 presented the parasite DNA, representing a prevalence of 7.71% in the population studied. Positivity indices for PCR and qPCR were 3.48 (14/402) and 7.21% (29/402), respectively. Comparison of the results obtained by both techniques showed moderate agreement (Kappa = 0.5364). Of the independent variables analyzed, presence of clinical signs (p≤0.05) was the only one associated with CVL. Based on this study, we conclude that VL is a circulating disease, with relatively low prevalence, in dogs of Barão de Melgaço/MT, and that the presence of clinical signs is the only variable associated with canine infection.

Download Full-text

Molecular detection of Anaplasma platys, Anaplasma phagocytophilum and Wolbachia sp. but not Ehrlichia canis in Croatian dogs

Parasitology Research ◽

10.1007/s00436-017-5611-y ◽

2017 ◽

Vol 116 (11) ◽

pp. 3019-3026 ◽

Cited By ~ 6

Author(s):

Doroteja Huber ◽

Irena Reil ◽

Sanja Duvnjak ◽

Daria Jurković ◽

Damir Lukačević ◽

...

Keyword(s):

Anaplasma Phagocytophilum ◽

Molecular Detection ◽

Ehrlichia Canis ◽

Anaplasma Platys

Download Full-text

Molecular detection of Anaplasma platys, Ehrlichia canis, Hepatozoon canis and Rickettsia monacensis in dogs from Maio Island of Cape Verde archipelago

Ticks and Tick-borne Diseases ◽

10.1016/j.ttbdis.2016.05.001 ◽

2016 ◽

Vol 7 (5) ◽

pp. 964-969 ◽

Cited By ~ 18

Author(s):

Stefania Lauzi ◽

João P. Maia ◽

Sara Epis ◽

Ricardo Marcos ◽

Cristina Pereira ◽

...

Keyword(s):

Molecular Detection ◽

Cape Verde ◽

Ehrlichia Canis ◽

Hepatozoon Canis ◽

Anaplasma Platys ◽

Rickettsia Monacensis

Download Full-text

Molecular detection of equine herpes virus-1 in local horses (Equus feruscaballus) and donkeys (Equus asinus)

The Iraqi Journal of Veterinary Medicine ◽

10.30539/iraqijvm.v42i1.34 ◽

2018 ◽

Vol 42 (1) ◽

pp. 72-78

Author(s):

Karim Sadun Ali Al-Ajeeli

Keyword(s):

Polymerase Chain Reaction ◽

Molecular Detection ◽

Clinical Signs ◽

Epidemiological Studies ◽

Buffy Coat ◽

Chain Reaction ◽

Cervical Lymph Nodes ◽

Equus Asinus ◽

Reverse Primer ◽

Polymerase Chain

Equine herpsvirus type1 was classified as a member of the subfamily Alphaherpesvirinae. It was reported to cause respiratory, reproductive and neurologic infection in horses. The reproductive form of the disease induces abortion in pregnant mare, while the neurologic form is associated with paralysis of infected horses. This study was designed for molecular detection of Equine herpsvirus type1 by polymerase chain reaction. Blood buffy coat samples were collected from 25 horses (Equus feruscaballus) and 25 donkeys (Equus asinus) admitted to local private veterinary clinics around Baghdad and Baaquba cities. DNA was extracted from such samples by the use of DNA extraction kit of COLLECTAGENET .The samples were subjected to conventional PCR test using specific primers for gB gene of equine herepesvirus-1. Forward primer (F) (5’ TAACTGAGATCT AACCGAC 3’) and reverse primer (R) (CATATATAGCTATCACGTCC 3’). One buffy coat sample from aborted mare and one buffy coat sample from a donkey suffering from acute respiratory clinical signs were inoculated in mice to follow the fate of equine herepesvirus-1in nasal turbinates, cervical lymph nodes and lungs of these mice. The results showed that only 4 samples from horses and 2 samples from donkeys were positive to polymerase chain reaction. Experimentally infected mice did not show any clinical signs but they were positive to polymerase chain reaction, and the virus easily terminated, probably due to low dose of the virus and host specificity. It can be concluded that local horses and donkeys, somewhere have had infected with equine herepesvirus-1, and became latent carriers for the virus. Furthermore, microbiological and epidemiological studies on local Equine herpsvirus type1 and Equine herpsvirus type 4 are recommended.

Download Full-text

Molecular detection of Ehrlichia canis, Anaplasma bovis, Anaplasma platys, Candidatus Midichloria mitochondrii and Babesia canis vogeli in ticks from Israel

Clinical Microbiology and Infection ◽

10.1111/j.1469-0691.2010.03316.x ◽

2011 ◽

Vol 17 (3) ◽

pp. 459-463 ◽

Cited By ~ 59

Author(s):

S. Harrus ◽

A. Perlman-Avrahami ◽

K.Y. Mumcuoglu ◽

D. Morick ◽

O. Eyal ◽

...

Keyword(s):

Molecular Detection ◽

Ehrlichia Canis ◽

Babesia Canis ◽

Anaplasma Platys ◽

Anaplasma Bovis ◽

Midichloria Mitochondrii

Download Full-text

Molecular epidemiology of Anaplasma platys, Ehrlichia canis and Babesia vogeli in stray dogs in Paraná, Brazil

Pesquisa Veterinária Brasileira ◽

10.1590/s0100-736x2017000200006 ◽

2017 ◽

Vol 37 (2) ◽

pp. 129-136 ◽

Cited By ~ 8

Author(s):

Claudia M. Ribeiro ◽

Aldair C. Matos ◽

Thainá Azzolini ◽

Everton R. Bones ◽

Eduardo A. Wasnieski ◽

...

Keyword(s):

Rhipicephalus Sanguineus ◽

Molecular Study ◽

Ehrlichia Canis ◽

Anaplasma Platys ◽

Amblyomma Cajennense ◽

Blood Samples ◽

Babesia Vogeli ◽

Polymerase Chain ◽

Hematological Changes ◽

The City

ABSTRACT: Hemoparasitic infections are tick-borne diseases, which affect animals and humans. Considering the importance of canine hemoparasitic infections in veterinary clinics, this study aimed to determine the occurrence of Anaplasma platys, Ehrlichia canis and Babesia vogeli in blood samples from 182 dogs not domiciled in the city of Pato Branco, southwestern region of Paraná State, Brazil, using polymerase chain reaction (PCR). The prevalence of A. platys and B. vogeli was 32.9% and 10.9% respectively, and A. platys infection prevailed (p<0.001). The number of dogs positive for A. platys was larger in Winter (p<0.05). All blood samples were negative for E. canis. In the dogs, infestation by Amblyomma cajennense predominated over that by Rhipicephalus sanguineus (p<0.001); but there was no significant association between PCR and the variables presence of ticks, sex and age. Dogs infected by A. platys and B. vogeli showed thrombocytopenia, lymphopenia and leukocytosis; but there was no correlation between such hematological changes and infection by hemoparasites. This appears to be the first molecular study that demonstrates the existence of A. platys and B. vogeli in dogs from the southwestern region of Paraná.

Download Full-text