Differential expression profiling of defense related genes for Leaf Curl Virus (ChiLCV) in resistant and susceptible genotypes of Chiili

2020 ◽  
Vol 80 (03) ◽  
Author(s):  
Manisha Mangal ◽  
Arpita Srivastava ◽  
Shriram J. Mirajkar ◽  
Khushbu Singh ◽  
Vikas Solanki ◽  
...  
Keyword(s):  
Expression Profiles ◽  
Specific Pattern ◽  
Post Inoculation ◽  
Resistant Line ◽  
Challenge Inoculation ◽  
Resistant Genotype ◽  
Active Defense ◽  
Leaf Curl Virus ◽  
Differential Expression Profiling ◽  
Leaf Curl

The present investigation was undertaken to study the expression of eight defense related genes in leaf curl resistant line DLS-Sel-10 and susceptible line Phule Mukta after different days post inoculation (dpi) with viruliferous white flies to understand their role in resistance to chilli leaf curl virus (ChiLCV). The expression level of Ca PPO, Ca AsPer, Ca ATP/ADP and CaTopoII was observed to be higher in resistant genotype DLS-Sel-10 than the susceptible Phule Mukta at all the time points studied. Expression of CaNBS-LRR increased up to 12 dpi while that of Ca Thionin, and Ca SKP1 increased up to 24 dpi in the resistant line, thereafter it started declining. The CaSPI expression did not show any specific pattern in both the test plants. The heat map clustered all the genes under study into two major clusters based on their expression profiles, one comprising CaAsPer, Ca-Thionin, CaATP/ADP transporter, CaPPO and CaTopoII while other group comprised CaSKPI, Ca NBS and CaSPI. The challenge inoculation of the test genotypes also revealed that viral titre increased at a much slower rate in DLS-Sel-10 than Phule Mukta, suggesting thereby that DLS-Sel-10 is resisting the accumulation of ChiLCV and has a more active defense machinery than Phule Mukta.

scholarly journals Use of Tomato yellow leaf curl virus (TYLCV) Rep Gene Sequences to Engineer TYLCV Resistance in Tomato

2004 ◽  
Vol 94 (5) ◽  
pp. 490-496 ◽  
Author(s):  
Y. Yang ◽  
T. A. Sherwood ◽  
C. P. Patte ◽  
E. Hiebert ◽  
J. E. Polston
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Gene Sequences ◽  
Tomato Production ◽  
Challenge Inoculation ◽  
Biolistic Inoculation ◽  
Polymerase Chain ◽  
The Tropics ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), Δ2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and RepΔ2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to Δ2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

Genetic analysis for resistance to leaf curl disease in Chilli Peppers (Capsicum annuum L.) under specific situations

2020 ◽  
Vol 79 (04) ◽  
Author(s):  
Pradeep Kumar Maurya ◽  
Arpita Srivatstava ◽  
Manisha Mangal ◽  
Akshay Talukdar ◽  
Bikash Mondal ◽  
...  
Keyword(s):  
Recessive Gene ◽  
Viral Disease ◽  
Specific Marker ◽  
Chi Square ◽  
Resistant Genotype ◽  
Chi Square Test ◽  
Leaf Curl Virus ◽  
Chilli Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Leaf curl is a serious viral disease of chilli caused by a group of bigomoviruses dominated by chilli leaf curl virus (ChiLcv). With the aim to study the mode of inheritance of the ChiLcv disease resistance, a resistant genotype DLS-Sel.10 was crossed with a susceptible genotype Phule Mukta and F1, F2, B1 and B2 generations were developed. The parents along with the segregating generations were screened under natural conditions as well as challenged inoculation with viruliferous whiteflies carrying predominant ChiLcv.PCR amplification of viral genome-specific marker confirmed the presence of virus in all the tested plants however, only susceptible plants produced symptoms. The F1 plants showed susceptibility under both natural and challenged inoculation conditions indicating that the resistance is of recessive nature. On Chi-square test, it was found that susceptible and resistant plants of the two F2populations segregated in a ratio of 3 susceptible : 1 resistant plants and the B2 population derived from DLS-Sel.10/Phule Mukta//DLS-Sel.10 segregated in a ratio of 1 resistant : 1 susceptible plant suggesting that the Chilcv is goverened by a single recessive gene. The findings of this study will help in breeding for ChiLcv resistance in Chilli.

scholarly journals Identification of Chili leaf curl virus Causing Leaf Curl Disease of Petunia in Oman

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 572-572 ◽  
Author(s):  
A. A. Al-Shihi ◽  
S. Akhtar ◽  
A. J. Khan
Keyword(s):  
Indian Subcontinent ◽  
Rolling Circle Amplification ◽  
Rapid Evolution ◽  
Post Inoculation ◽  
Multiple Sequence ◽  
Rolling Circle ◽  
Begomovirus Genome ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Petunias (Petunia × hybrida) are the most important ornamental plants in Oman. In 2012, petunias were observed in public parks and airport landscape in Dhofar region with symptoms of upward leaf curling, yellowing and vein clearing, and size reduction in leaves. Almost all plants in the surveyed landscape showed high infestation of Bemisia tabaci and symptoms that suggested infection with a begomovirus. Six symptomatic samples were collected from three different sites. All symptomatic samples were found PCR-positive with diagnostic primers for begomovirus (3) when DNA extracted from infected leaves was used as template. Nucleic acids extracted from the symptomatic leaves were used to amplify circular DNA molecules by rolling circle amplification method. The amplified concatameric products were digested with restriction enzyme PstI, which yielded a product ∼2.8 kb in size. The putative begomovirus fragment was cloned and sequenced in both orientations. Partial sequences of six clones were 99 to 100% similar and thus only two clones, PT-2 and PT-3, were fully sequenced. The whole genomes of both clones were 2,761 bp, and both were deposited in GenBank under accession numbers HF968755 and HF968756 for the isolates PT-2 and PT-3, respectively. Both sequences had six open reading frames; Rep, TrAP, REn, and C4 genes in complementary sense; and CP and V2 genes in virion-sense, typical of the begomovirus genome organization. Upon alignment, the two sequences showed 99.4% nucleotide identity with each other, thus representing isolates of a single begomovirus species. BlastN comparison showed PT-2 and PT-3 from petunia were 94 to 95% identical to the sequences of ChCLV from Oman (JN604490 to JN604500), which were obtained from other hosts. ClustalV multiple sequence alignment showed that isolates PT-2 and PT-3 shared maximum sequence identity of 93.3 and 92.8%, respectively, with an isolate of ChLCV-OM (JN604495). According to ICTV rules for begomoviruses, PT-3 should be considered to be a new strain of ChLCV-OM and PT-2 a variant of the already existing ChLCV-OM strain. We propose the name for this new strain as the “Petunia strain” of Chili leaf curl virus (ChLCV-Pet). Two infectious clones were constructed from the PT-2 and PT-3 sequences, clones as 1.75-genome sequences in a binary vector, suitable for agroinfection to confirm their infectivity. Both clones, PT-2 and PT-3, produced typical leaf curl disease symptoms upon inoculation on petunia 18 days post inoculation. The presence of the same virus in symptomatic field infected and inoculated petunia was confirmed by Southern blot using 650 bp DIG labeled probe prepared from CP region of PT-3 isolate. ChLCV-OM, a monopartite begomovirus, is widely associated with leaf curl disease of tomato and pepper in Oman, with its origin traced to the Indian subcontinent (2). Identification of a new strain of ChLCV from petunia provides evidence of an ongoing rapid evolution of begomoviruses in this region. Although petunia has been tested as an experimental host for some begomoviruses (1,4), this is the first report of petunia as natural host for ChLCV, a begomovirus previously reported in tomato and pepper in Oman. References: (1) Cui et al. J. Virol. 78:13966, 2004. (2) Khan et al. Virus Res. 177:87, 2013. (3) Khan et al. Plant Dis. 97:1396, 2013. (4) Urbino et al. Arch. Virol. 149:417, 2003.

scholarly journals First report of lettuce necrotic leaf curl virus infecting cultivated lettuce in France

Plant Disease ◽  
2020 ◽  
Author(s):  
Laurence Svanella-Dumas ◽  
Armelle Marais ◽  
Chantal Faure ◽  
Marie Lefebvre ◽  
Jonathan Gaudin ◽  
...  
Keyword(s):  
The Netherlands ◽  
Open Field ◽  
Sequence Data ◽  
Natural Infection ◽  
Post Inoculation ◽  
Sequencing Analysis ◽  
First Report ◽  
Reference Isolate ◽  
Leaf Curl Virus ◽  
Leaf Curl

Lettuce necrotic leaf curl virus (LNLCV, genus Torradovirus, family Secoviridae) has a bipartite single-stranded RNA genome and has so far only been reported in the Netherlands in open field lettuce (Verbeek et al. 2014). It was the first Torradovirus described from non-tomato host and, contrary to whitefly-transmitted tomato torradoviruses, aphids are its natural vectors (Verbeek et al. 2017). In October 2019, a symptomatic lettuce (JG3, cv. “Tregoney”) was collected in an open field in southwestern France. Symptoms included stunted and deformed leaves with light necrosis and yellow spotting along minor veins of older leaves. Double-stranded RNAs were purified from JG3 leaves as described (Marais et al. 2018) and a cDNA library prepared and analyzed by Illumina NovaSeq sequencing. Analysis of sequence data identified two nearly fully assembled RNAs integrating respectively 28.9% and 60.9% of the sequencing reads and sharing respectively 85.5% and 83.3% nucleotide (nt) identity with the RNAs 1 and 2 of the LNLCV reference isolate, (NC_035214 and NC_035219, respectively). To confirm the presence of LNLCV in the original JG3 plant, it was used to mechanically inoculate indicator Nicotiana benthamiana, Chenopodium quinoa and C. amaranticolor plants. Only N. benthamiana developed symptoms, in the form of smaller and yellowed leaves. All inoculated plants were tested one month post-inoculation for the presence of LNLCV. Total RNAs were extracted according to Foissac et al. (2005) and used for RT-PCR tests with primers designed from the alignment between NC_035214 and our RNA1 sequence (LNLCV-S 5’-ATATTTTCCAAGTTGGAGGCTC-3’ and LNLCV-R 5’-AGTRACAAAGGGACTAACTG-3’). LNLCV was detected in 3 out of 4 inoculated N. benthamiana plants. The full length RNA1 sequence (7577 nt) and the near complete RNA2 (5286 nt, lacking 3 nt at the 5’ end as compared to NC_035219) could be assembled from the JG3 sequencing data and have been deposited in GenBank (MW172270 and MW172271, respectively). The lettuce JG3 isolate RNA1 shows 86.5% nt identity with the reference isolate while the taxonomically informative protease-polymerase regions share 96.8% aa identity. JG3 RNA2 shares 84.8% nt identity with NC_035219 while the movement protein and capsid subunits share respectively 92.5% and 98.3% aa identity. The smaller upstream ORF that slightly overlaps with the large MP-CP1/2/3 ORF is also conserved and shows 94.8% aa identity with the reference isolate. To our knowledge, this represents the first report of a natural infection of LNLCV in cultivated lettuce in France and anywhere outside the Netherlands. Since no other viruses were detected in the sequence dataset, LNLCV is most likely responsible for the mild necrosis and leaf deformation symptoms observed on the JG3 plant that appear to be similar to those initially described for LNLCV (Verbeek et al. 2014). While the pathogenicity of LNLCV in lettuce appears to be firmly established, further studies are needed to establish its distribution and prevalence, to understand why this pathogenic and aphid-transmitted virus is not more widely reported and whether it has the potential to increase in impact as a potential emerging agent on field lettuce crops.

scholarly journals Transcriptome Analysis of Gene Expression Profiles of Tomato Yellow Leaf Curl Virus-Infected Whiteflies over Different Viral Acquisition Access Periods

Insects ◽  
2020 ◽  
Vol 11 (5) ◽  
pp. 297 ◽  
Author(s):  
Meng Li ◽  
Jing Zhao ◽  
Yun-Lin Su
Keyword(s):  
Transcriptome Analysis ◽  
Molecular Level ◽  
Expression Profiles ◽  
Gene Expression Profiles ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Transcriptional Responses ◽  
Tomato Production ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), which is transmitted by Bemisia tabaci in a persistent-circulative manner, threatens tomato production worldwide. Little is known about the complicated interaction during this process at the molecular level. In this study, viral AAPs at 0 h, 2 h, 6 h, 12 h and 48 h were investigated using a comparative transcriptome analysis to uncover the transcriptional responses of whiteflies to virus infection. Our results have shown that 755, 587, 1140 and 1347 differentially expressed genes (DEGs) were identified in the comparisons of the data of 0 h vs. 2 h, 0 h vs. 6 h, 0 h vs. 12 h and 0 h vs. 48 h, respectively. KEGG analysis showed that DEGs associated with metabolisms and signal transduction were down-regulated in virus-infected whiteflies. Additionally, 16 up-regulated putative transporter genes and 10 down-regulated genes associated with IL-17 signaling pathway were identified by time-associated gene cluster analysis. These data boost our comprehensions on whitefly-TYLCV interactions associated with different viral AAPs.

scholarly journals First report of Sida leaf curl virus and associated betasatellite in tobacco

Plant Disease ◽  
2021 ◽  
Author(s):  
Duan Wang ◽  
Xuan Zhang ◽  
Dexin Chen ◽  
JIAN YE
Keyword(s):  
Virus Titer ◽  
Viral Metagenomics ◽  
Reference Sequence ◽  
Hainan Province ◽  
Post Inoculation ◽  
Sequencing Data ◽  
Nicotiana Glutinosa ◽  
Tobacco Genome ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tobacco (Nicotiana tabacum L.) is an economic crop and an important model plant for scientific research in the world. Cigar tobacco, a variety of tobacco, has been planted for industrial production in China since its introduction into the country in 2018 (Wang et al., 2021). In March 2020, symptoms like leaf curling, vein thickening and enation were frequently observed in cigar tobacco in several plantation areas of 100 hectares in Danzhou, Hainan Province, China (Fig. 1A). It was speculated that a geminivirus was the possible causing agent of the disease since the symptoms resembled those caused by geminiviruses besides the presence of their insect vectors - whiteflies. Five tobacco leaf samples were collected for DNA extraction, and pooled DNA was subjected to viral metagenomics analysis with Illumina Sequencing Technology (Illumina) at Tiangen Biotech, Beijing. A total of 67,774,552 filtered reads (99.84%) were matched to tobacco genome, and the remaining 110,908 reads (0.16%) were analyzed by BLASTn against GenBank virus Refseq Database with E-value smaller than 1e-6. Among the virus-matching sequencing data obtained, 65 and 2,058 reads were annotated as genomes of sida leaf curl virus (SiLCV, reference sequence: NC_007638) and its associated betasatellite (SiLCB, reference sequence: NC_007639), accounting for 3% and 95%, respectively. Thirty six reads matched to sweet potato vein clearing virus (reference sequence: NC_015228), and 7 reads matched to Emiliania huxleyi virus (reference sequence: JF429838). We speculated the causing pathogen of this disease might be SiLCV and its associated betasatellite. We next designed primers SiLCV-DNA-A-F/SiLCV-DNA-A-R (SiLCV-DNA-A-F: GAATTCTTTTCCTCGTCCAGG; SiLCV-DNA-A-R: CGCTTTAAAGACTTGGGCTTT) and SiLCV-β-F/SiLCV-β-R (SiLCV-β-F: ACCGGTGGCGAGCTGGTGTCT; SiLCV-β-R: AATATTAGAACGGTGGCGAGC) to amplify the complete genome of SiLCV and its associated betasatellite, respectively (Table S1). As expected, all five tobacco DNA samples were PCR-positive for the two sets of primers. Thereafter, the amplicons from one sample (Fig. 1B) were fully sequenced by Sanger sequencing at Tiangen Biotech, Beijing. The anticipated SiLCV genome with a length 2,760 nucleotides (accession no. MW465952) and its associated betasatellite with a length of 1,369 nucleotides (accession no. MW465953) exhibited the highest sequence identity of 93.5% and 95.6% with that of SiLCV isolate 61 (DQ641706; Ha et al., 2008) and isolate Hn57 (AM050732.1; Guo and Zhou 2006), respectively. This SiLCV isolate identified in Hainan province is named as SiLCV-HN, and its associated betasatellite is named as SiLCB-HN. Infectious clones of SiLCV-HN and SiLCB-HN were constructed by ligating two complete genomes of each SiLCV-HN and SiLCB-HN to a binary expression vector pCAMBIA1300 as previously described (Wang et al. 2019). Next, SiLCV-HN alone or co-infiltrated SiLCV-HN and SiLCB-HN were infiltrated into Nicotiana benthamiana. At 5 days post inoculation (5 dpi), typical begomovirus symptoms such as severe down-curl on newly emerging leaves displayed in SiLCV-HN and SiLCB-HN co-infiltrated N. benthamiana plants. Agroinoculation of N. benthamiana plants with SiLCV-HN alone showed severe leaf up-curl symptom at 12 dpi (Fig. 1C). Quantitative PCR results showed that the virus titer was higher in SiLCV-HN/SiLCB-HN co-infected plants in comparison to plants infected with SiLCV-HN individually (Fig. 1D). Typical virus symptoms and SiLCV DNA could also be detected in a wild tobacco species Nicotiana glutinosa when agroinfiltration-based infection was done, even though at a low infection efficacy (Fig. 1E and 1F). We could not make successful agroinfiltration-based infection of SiLCV in cigar tobacco due to unknown reasons. Nevertheless our data suggest that SiLCV-HN could infect species from Nicotiana genus and therefore poses severe threats to tobacco industry. References: Guo, X. J., & Zhou, X. P., 2006. Virus Genes. 10.1007/s11262-006-0066-8. Ha C., et al., 2008, The Journal of general virology. 10.1099/vir.0.83236-0. Wang, D., et al., 2019. Molecular plant-microbe interactions. 10.1094/MPMI-06-19-0163-FI. Wang, Y. Y., et al., 2021. Frontiers in plant science. 10.3389/fpls.2021.618133.

Control of the Bemisia tabaci/Tomato yellow leaf curl virus complex on protected tomato crops in Algarve (Portugal)*

EPPO Bulletin ◽  
2002 ◽  
Vol 32 (1) ◽  
pp. 31-35
Author(s):  
A. F. Arsenio ◽  
E. Neto ◽  
N. Ramos ◽  
S. Mangerico ◽  
E. Fortunato ◽  
...  
Keyword(s):  
Bemisia Tabaci ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Virus Complex ◽  
Leaf Curl Virus ◽  
Leaf Curl

Study of a collection of tomato hybrids with genetic resistance to the yellow leaf curl virus in Southern Russia

2020 ◽  
pp. 30-34
Author(s):  
С.Ф. Гавриш ◽  
Т.А. Редичкина ◽  
А.В. Буц ◽  
Г.М. Артемьева
Keyword(s):  
Resistance Genes ◽  
Molecular Genetic Analysis ◽  
Tomato Yellow Leaf ◽  
Tomato Mosaic Virus ◽  
Average Weight ◽  
Yellow Leaf ◽  
The South ◽  
Economically Valuable Traits ◽  
Leaf Curl Virus ◽  
Leaf Curl

Дана информация об изучении коллекции гибридов F1томата (Solanum lycopersicum L.) зарубежной селекции различных фирм-оригинаторов, рекомендованных производителями семян как толерантные к вирусу желтой курчавости листьев томата. Все гибриды обладали комплексом хозяйственно ценных признаков и набором генов устойчивости к основным заболеваниям томата, в том числе к новому для юга России опасному патогену с максимальным потенциальным риском – вирусу желтой курчавости листьев томата (Tomato yellow leaf curl virus — TYLCV). Исследования проведены в 2017-2018 годах в лаборатории пасленовых культур ООО «НИИСОК» и в лаборатории молекулярной диагностики растений ООО «Семеновод». Всего было протестировано 34 гибрида F1 томата. Гибриды оценивали по совокупности хозяйственно ценных признаков, также проводили молекулярно-генетический анализ на наличие и аллельное состояние основных генов устойчивости: к вирусу табачной мозаики (Tm2а), фузариозному увяданию (I2), вертициллезному увяданию (Ve), к кладоспориозу (Cf9), нематодам (Mi1.2), вирусу бронзовости томата (Sw5), вирусу желтой курчавости листьев томата (Ty3a). Установлено, что все проанализированные гибриды томата с заявленной оригинаторами семян устойчивостью к вирусу желтой курчавости листьев были гетерозиготны по гену Ty3a. На основании проведенных исследований и с учетом требований рынка разработаны модели гибридов F1 томата юга России. Перспективный гибрид томата должен обладать индетерминантным типом роста с укороченными междоузлиями (4,5-5 см) а также хорошей облиственностью. Плоды томата должны быть с красной равномерной окраской без зеленого пятна у плодоножки, с плоскоокруглой или округлой формой плода и со средней массой 220-270 г. Для повышения транспортабельности томатов необходимо, чтобы плоды отличались высокой прочностью и характеризовались хорошей лежкостью. Урожайность гибрида томата должна быть более 30 кг/м2, а товарность - не менее 85%. Гибрид томата должен обладать следующим набором генов устойчивости в гетерозиготном состоянии: Ty3a, Mi1.2, Cf-9, а также в гомозиготном состоянии: Tm2a, I2, Ve. The article provides information on the study of the collection of F1 tomato hybrids (Solanum lycopersicumL.) of foreign breeding from various firms-originators recommended for cultivation in regions with a strong spread of tomato yellow leaf curl virus. All hybrids had a complex of economically valuable traits and a set of genes for resistance to the main diseases of tomato, including a new dangerous pathogen for the South of Russia with a maximum potential risk — the tomato yellow leaf curl virus (TYLCV). The studies were carried out in 2017-2018 in the Solanaceae Laboratory of LLC NIISOK and in the Molecular Diagnostics Laboratory of Plants of LLC Semenovod. A total of 34 F1 tomato hybrids were tested. The hybrids were assessed by a set of economically valuable traits. Molecular genetic analysis was also carried out for the presence and allelic state of the main resistance genes: Tomato mosaic virus (Tm2a), Fusarium wilt (I2), Werticillium wilt (Ve), Cladosporium fulvum (Cf9), Nematodes (Mi1.2), Tomato spotted wilt virus (Sw5), Tomato yellow leaf curl virus (Ty3a). It was found that all the analyzed tomato hybrids with the declared by seed originators resistance to yellow leaf curl virus were heterozygous for the Ty3a gene. Based on the conducted research and taking into account the market requirements, models of F1 tomato hybrids for protected ground for the South of Russia have been developed. A promising tomato hybrid should have an indeterminate growth type with shortened internodes (4.5-5 cm) and good foliage. Tomato fruits should have a uniform red color without green shoulders, with a flat-round or round shape of the fruit and with an average weight of 220-270 g. To increase the transportability of tomatoes, it is necessary that the fruits are highly firm and characterized by good shelf life. The yield of tomato hybrid should be more than 30 kg/m2, and marketability should be at least 85%. The tomato hybrid should have the following set of resistance genes in a heterozygous state: Ty3a, Mi1.2, Cf-9, and also in a homozygous state: Tm2a, I2, Ve.

scholarly journals PSIV-11 Effects of very low-dose antibiotics on gene expression profiles in ileal mucosa of weaned pigs infected with a pathogenic E. coli

2020 ◽  
Vol 98 (Supplement_4) ◽  
pp. 286-286
Author(s):  
Kwangwook Kim ◽  
Sungbong Jang ◽  
Yanhong Liu
Keyword(s):  
Gene Expression ◽  
Systemic Inflammation ◽  
Low Dose ◽  
Expression Profiles ◽  
Gene Expression Profiles ◽  
Post Inoculation ◽  
Growth Promoter ◽  
Weaned Pigs ◽  
Ileal Mucosa ◽  
E Coli

Abstract Our previous studies have shown that supplementation of low-dose antibiotic growth promoter (AGP) exacerbated growth performance and systemic inflammation of weaned pigs infected with pathogenic Escherichia coli (E. coli). The objective of this experiment, which is extension of our previous report, was to investigate the effect of low-dose AGP on gene expression in ileal mucosa of weaned pigs experimentally infected with F18 E. coli. Thirty-four pigs (6.88 ± 1.03 kg BW) were individually housed in disease containment rooms and randomly allotted to one of three treatments (9 to 13 pigs/treatment). The three dietary treatments were control diet (control), and 2 additional diets supplemented with 0.5 or 50 mg/kg of AGP (carbadox), respectively. The experiment lasted 18 d [7 d before and 11 d after first inoculation (d 0)]. The F18 E. coli inoculum was orally provided to all pigs with the dose of 1010 cfu/3 mL for 3 consecutive days. Total RNA [4 to 6 pigs/treatment on d 5; 5 to 7 pigs/treatment on 11 post-inoculation (PI)] was extracted from ileal mucosa to analyze gene expression profiles by Batch-Tag-Seq. The modulated differential gene expression were defined by 1.5-fold difference and a cutoff of P < 0.05 using limma-voom package. All processed data were statistically analyzed and evaluated by PANTHER classification system to determine the biological process function of genes in these lists. Compared to control, supplementation of recommended-dose AGP down-regulated genes related to inflammatory responses on d 5 and 11 PI; whereas, feeding low-dose AGP up-regulated genes associated with negative regulation of metabolic process on d 5, but down-regulated the genes related to immune responses on d 11 PI. The present observations support adverse effects of low-dose AGP in our previous study, indicated by exacerbated the detrimental effects of E. coli infection on pigs’ growth rate, diarrhea and systemic inflammation.

Sign in / Sign up

Export Citation Format

Share Document