Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

Sequence polymorphism of the waxy gene in waxy maize accessions and characterization of a new waxy allele

Waxy maize has many excellent characteristics in terms of its nutritional and economic value. In recent decades, the waxy maize germplasm has increased dramatically as a result of different selection methods. We collected 200 waxy maize inbred accessions from different origins to study their genetic diversity and phylogenetic relationships, and to identify new waxy mutations. A simple sequence repeat (SSR) analysis revealed wide genetic diversity among the 200 waxy maize accessions. The maize accessions were clustered into three groups. We sequenced the waxy gene from the first to the 14th exon. Nucleotide variation analysis of 167 waxy maize and 14 flint maize lines revealed some nucleotide differences in the waxy gene among different waxy maize groups, and much narrower nucleotide diversity in waxy maize than in flint maize. In a phylogenetic analysis, waxy maize carrying the same mutation allele clustered together, and waxy maize carrying different mutation alleles distributed in different groups; waxy maize was intermixed with flint maize in each branch, and wx-D7 waxy maize separated significantly from waxy maize lines carrying wx-D10, wx-124 and wx-hAT mutant alleles. The wx-hAT was a new waxy mutation identified in this study. It consisted of a 2286-bp transposon inserted into the middle of exon three of the waxy gene. A PCR marker specific for the wx-hAT allele was developed. These results will be useful for the utilization and preservation of the waxy maize germplasm, and the PCR marker has potential uses in waxy maize breeding programs.

Fast and Inexpensive Phenotyping and Genotyping Methods for Evaluation of Barley Mutant Population

To further develop barley breeding and genetics, more information on gene functions based on the analysis of the mutants of each gene is needed. However, the mutant resources are not as well developed as the model plants, such as Arabidopsis and rice. Although genome editing techniques have been able to generate mutants, it is not yet an effective method as it can only be used to transform a limited number of cultivars. Here, we developed a mutant population using ‘Mannenboshi’, which produces good quality grains with high yields but is susceptible to disease, to establish a Targeting Induced Local Lesions IN Genomes (TILLING) system that can isolate mutants in a high-throughput manner. To evaluate the availability of the prepared 8043 M3 lines, we investigated the frequency of mutant occurrence using a rapid, visually detectable waxy phenotype as an indicator. Four mutants were isolated and single nucleotide polymorphisms (SNPs) were identified in the Waxy gene as novel alleles. It was confirmed that the mutations could be easily detected using the mismatch endonuclease CELI, revealing that a sufficient number of mutants could be rapidly isolated from our TILLING population.

Waxy Gene-Orthologs in Wheat × Thinopyrum Amphidiploids

Starch, as the main component of grain in cereals, serves as the major source of calories in staple food and as a raw material for industry. As the technological and digestive properties of starch depend on its content, the management of its components, amylose and amylopectin, is of great importance. The starch properties of wheat grain can be attuned using allelic variations of genes, including granule-bound starch synthase I (GBSS I), or Wx. The tertiary gene pool, including wheatgrass (Thinopyrum) species, provides a wide spectrum of genes-orthologs that can be used to increase the allelic diversity of wheat genes by wide hybridization. Octaploid partial wheat–wheatgrass hybrids (amphidiploids, WWGHs) combine the complete genome of bread wheat (BBAADD), and a mixed genome from the chromosomes of intermediate wheatgrass (Thinopyrum intermedium, genomic composition JrJrJvsJvsStSt) and tall wheatgrass (Th. ponticum, JJJJJJJsJsJsJs). Thus, WWGHs may carry Wx genes not only of wheat (Wx-B1, Wx-A1 and Wx-D1) but also of wheatgrass origin. We aimed to assess the level of amylose in starch and investigate the polymorphism of Wx genes in 12 accessions of WWGHs. Additionally, we characterized orthologous Wx genes in the genomes of wild wheat-related species involved in the development of the studied WWGHs, Th. intermedium and Th. ponticum, as well as in the putative donors of their subgenomes, bessarabian wheatgrass (Th. bessarabicum, JbJb) and bluebunch wheatgrass (Pseudoroegneria stipifolia, St1St1St2St2). Although no significant differences in amylose content were found between different WWGH accessions, SDS-PAGE demonstrated that at least two WWGHs have an additional band. We sequenced the Wx gene-orthologs in Th. bessarabicum, P. stipifolia, Th. intermedium and Th. ponticum, and developed a WXTH marker that can discriminate the Thinopyrum Wx gene in the wheat background, and localized it to the 7E chromosome in Th. elongatum. Using the WXTH marker we revealed the allelic polymorphism of the Thinopyrum Wx gene in the studied WWGHs. The applicability of Thinopyrum Wx genes in wheat breeding and their effect on starch quality are discussed.

Wxlv, the Ancestral Allele of Rice Waxy Gene

In rice endosperms, the Waxy (Wx) gene is important for amylose synthesis, and various Wx alleles control the amylose content and affect the taste of cooked rice. Herein, we report the cloning of the ancestral allele Wxlv of the Wx locus, which affects the mouthfeel of rice grains by modulating the size of amylose molecules. Using evolutionary analysis, we demonstrated that Wxlv originated directly from wild rice, and the three major Wx alleles in cultivated rice (Wxb, Wxa, and Wxin) differentiated after the substitution of one base pair at the functional sites. These data indicate that the Wxlv allele played an important role in artificial selection and domestication. The findings also shed light on the evolution of various Wx alleles, which have greatly contributed to improving the eating and cooking quality of rice.

SSR loci potentially associated with high amylopectine content in maize kernel endosperm

As a component of functional nutrition, maize cultivars with “non-traditional” kernel composition (waxy, oilbearing, sugar, opaque, etc. phenotypic variants) are promising. Mutations in the waxy gene, which break down the structure and function of the enzyme for amylose biosynthesis, lead to a waxy (with a high content of amylopectin) endosperm formation. High variability of the waxy gene limits the use of microsatellite loci in marker associated selection of waxy maize genotypes. The increased frequency of gene rearrangements within the waxy locus facilitated the origination of many high-amylopectin corn lines carrying different SSR allelic variants. The purpose of this study was to evaluate the effectiveness of using waxy locus microsatellite sequences for identification and labeling of waxy maize genotypes. To this end, a complex of biochemical (calorimetry, bichromate method), molecular-genetic (SSR-PCR, capillary gel electrophoresis with fluorescent detection of fragments) and statistical (descriptive statistics, cluster analysis, χ2) analysis methods was used. Plant material used were 33 samples of corn kernels including mutant forms with a high content of amylose, amylopectin, short-chain starches, were kindly provided by VIR genetic collection (Russian Federation) and Maize Genetics Cooperation Stock Center (USA). The contents of starch, short-chain soluble carbohydrates, amylose, amylopectin in the grain of 33 maize samples were evaluated. Compositionally similar (to endosperm carbohydrates content) groups of samples were identified. They include 13 high-amylopectin samples carriers of waxy (wx) gene mutations and 20 samples with wild-type character (Wx). Molecular genetic screening of the collection included an analysis of the polymorphism of the microsatellite loci phi022, phi027, phi061 associated with the waxy gene sequence. Allelic composition of individual loci and their combinations were analyzed in relation to the accumulation of reserve carbohydrates in the kernel endosperm. Only the analysis of the phi022/phi027 combination or all three markers in the complex allows differentiating the wild Wx and mutant wx phenotypes of maize. It was shown that not the individual allelic polymorphisms of the phi022, phi027, phi061 loci are efficient for the markerassociated selection of high-amylopectin maize, but their unique combinations.