Real-time TaqMan RT-PCR for detection of maize chlorotic mottle virus in maize seeds

2011 ◽  
Vol 171 (1) ◽  
pp. 292-294 ◽  
Author(s):  
Yongjiang Zhang ◽  
Wenjun Zhao ◽  
Mingfu Li ◽  
Hongjun Chen ◽  
Shuifang Zhu ◽  
...  
Keyword(s):  
Real Time ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Maize Seeds ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle

scholarly journals First Report of Maize chlorotic mottle virus Infecting Maize in the Democratic Republic of the Congo

Plant Disease ◽  
2014 ◽  
Vol 98 (10) ◽  
pp. 1448-1448 ◽  
Author(s):  
M. Lukanda ◽  
A. Owati ◽  
P. Ogunsanya ◽  
K. Valimunzigha ◽  
K. Katsongo ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Democratic Republic ◽  
The United States ◽  
Mottle Virus ◽  
Rt Pcr ◽  
First Report ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Republic Of The Congo

Maize (Zea mays L.) is a major food and fodder crop cultivated on 1.54 million ha in the Democratic Republic of the Congo (DRC). In December 2013, unusually severe chlorotic mottle symptoms and pale green streaks were observed in local varieties (Mudishi 1 and 2, Bambou, Kasayi, H614, H613, and Mugamba) and exotic varieties (H520, H624, H403, HDK8031, and ZM607) in Beni, Lubero, and Rutshuru territories at 1,015 to 1,748 m elevation in North Kivu Province. Symptoms were prominent on newly emerging leaves that later developed marginal necrosis resembling the symptoms of maize lethal necrosis (MLN), caused by a dual infection of Maize chlorotic mottle virus (MCMV, genus Machlomovirus) and Sugarcane mosaic virus (SCMV, genus Potyvirus). Each of these viruses, but particularly MCMV, is also known to cause severe mosaic and mottling symptoms in maize (4). In January 2014, symptomatic and asymptomatic samples (n = 20) from disease-affected fields in Beni and Lubero provinces were collected for virus testing using Whatman FTA Classic Cards (1) and analyzed for MCMV (2681F: 5′-ATGAGAGCAGTTGGGGAATGCG and 3226R: 5′-CGAATCTACACACACACACTCCAGC) and SCMV (8679F: 5′-GCAATGTCGAAGAAAATGCG and 9595R: 5′-GTCTCTCACCAAGAGACTCGCAGC) by reverse transcription (RT)-PCR (4). Samples were also analyzed for Maize streak virus (MSV, genus Mastrevirus), an endemic virus in DRC, by PCR using MSV specific primers (MSV215-234: CCAAAKDTCAGCTCCTCCG and MSV1770-1792: TTGGVCCGMVGATGTASAG) (3). A DNA product of expected size (~520 bp) resulted only for MCMV in all the symptomatic plant samples. None of the samples tested positive for SCMV or MSV. RT-PCR analyses were performed to ascertain the absence of potyviruses using the degenerate potyvirus primers (CIFor: 5′GGIVVIGTIGGIWSIGGIAARTCIAC and CIRev: 5′ACICCRTTYTCDATDATRTTIGTIGC3′) (2) were also negative. Occurrence of MCMV in symptomatic samples was further confirmed by antigen-coated plate (ACP)-ELISA using anti-MCMV rabbit polyclonal antibodies produced at the Virology Unit, IITA, Ibadan, Nigeria. The RT-PCR product of MCMV was purified and sequenced in both directions (GenBank Accession No. KJ699379). Pairwise comparison of 518 bp nucleotide sequence corresponding to p32 and p37 open reading frames of MCMV by BLASTn search revealed 99.8% nucleotide sequence identity with an MCMV isolate from Kenya (JX286709), 98 to 99% identity with the isolates from China (JQ982468 and KF010583), and 96% identity with the isolates from the United States (X14736 and EU358605). MCMV is a newly emerging virus in Africa, first detected during a severe MLND outbreak in 2011 in Kenya (4). This disease has since become a serious threat to maize production in East Africa. MCMV has been reported in maize from Kenya, Rwanda, Tanzania, and Uganda. To our knowledge, this is the first report of MCMV occurrence in DRC. This finding confirms the further geographic expansion of MCMV and illustrates the need for further studies to identify vectors and also create awareness about the disease and to strengthen surveillance to prevent its further spread in the continent. References: (1) O. J. Alabi et al. J. Virol. Met. 154:111, 2008. (2) C. Ha et al. Arch. Virol. 153:25, 2008. (3) K. E. Palmer and E. P. Rybicki. Arch. Virol. 146:1089, 2001. (4) A. Wangai et al. Plant Dis. 96:1582, 2012.

Colorimetric detection of Maize chlorotic mottle virus by reverse transcription loop-mediated isothermal amplification (RT-LAMP) with hydroxynapthol blue dye

RSC Advances ◽  
2016 ◽  
Vol 6 (1) ◽  
pp. 73-78 ◽  
Author(s):  
Zhanmin Liu ◽  
Xueying Xia ◽  
Cuiyun Yang ◽  
Junyi Huang
Keyword(s):  
Reverse Transcription ◽  
Colorimetric Assay ◽  
Colorimetric Detection ◽  
Isothermal Amplification ◽  
Mottle Virus ◽  
Blue Dye ◽  
Maize Seeds ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle

Maize chlorotic mottle virus causes corn lethal necrosis disease, and can be transmitted via infected maize seeds. A colorimetric assay for the detection of Maize chlorotic mottle virus was developed which utilises RT-LAMP and hydroxynapthol blue dye (HNB).

scholarly journals Maize Seed Contamination and Seed Transmission of Maize Chlorotic Mottle Virus in Kenya

2021 ◽  
Author(s):  
Esther Nyambura Kimani ◽  
Samuel Mwaura Kiarie ◽  
Cyrus Mugambi Micheni ◽  
Laureen Gatwiri Muriki ◽  
Douglas Watuku Miano ◽  
...  
Keyword(s):  
Real Time ◽  
Transmission Rate ◽  
Seed Transmission ◽  
Rt Pcr ◽  
Maize Seed ◽  
Transmission Frequency ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Das Elisa

Maize chlorotic mottle virus (MCMV) causes maize lethal necrosis disease in combination with a cereal infecting potyvirus, leading to high yield losses. There is limited information on seed infection or contamination rate by MCMV and its comparison to transmission rate to maize seedlings. This study was conducted to determine the extent of seed contamination in seed lots from MCMV-infected maize fields in Kenya and the transmission of MCMV from seeds to seedlings. To determine the contamination levels, whole seeds were ground, and the extract tested for the presence of MCMV using double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). Seedling grow-outs were tested for seed transmission of MCMV using DAS-ELISA and real-time reverse transcription polymerase chain reaction (real-time RT-PCR) methods. The seed contamination rates of the four seed lots tested ranged from 4.9 to 15.9%. MCMV transmission frequency for 37,617 seedlings, tested in 820 pools of varying seed amounts by DAS-ELISA, was 0.17%, while a transmission frequency of 0.025% was obtained from 8,322 seedlings tested in 242 pools by real-time RT-PCR. Seeds from plants mechanically inoculated with MCMV had an overall seed transmission rate of 0.04% in 7,846 seedlings tested in 197 pools. The study showed that even with substantial contamination of maize seed with MCMV, the transmission of the virus from the seed to seedlings was low. Nevertheless, even low rates of transmission can be significant under field conditions where insect vectors can further spread the disease from infected seedlings, unless diseased plants are detected in time and properly managed.

scholarly journals First Report of Maize chlorotic mottle virus on Sweet Corn in Taiwan

Plant Disease ◽  
2014 ◽  
Vol 98 (12) ◽  
pp. 1748-1748 ◽  
Author(s):  
T.-C. Deng ◽  
C.-M. Chou ◽  
C.-T. Chen ◽  
C.-H. Tsai ◽  
F.-C. Lin
Keyword(s):  
Nucleotide Sequence ◽  
Mosaic Virus ◽  
Sweet Corn ◽  
Mottle Virus ◽  
Rt Pcr ◽  
First Report ◽  
Cp Gene ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle

In February 2014, a severe disease on maize (Zea mays L.) broke out in the fields of central and southwestern Taiwan and caused yield losses in sweet corn production. Chlorotic spots first appeared at the base of infected leaves and later developed into systemic mottling. Diffused necrotic patches were also found on leaves or husks of the diseased plants. Moreover, severe rosetting and stunting accompanied by abnormalities in ear production were observed on mature plants. Eighteen leaf samples from symptomatic plants were collected and submitted to our Plant Diagnostic Clinic for virus diagnosis. All of the samples were first tested by reverse transcriptase (RT)-PCR to detect Maize stripe virus (MSpV) and by indirect ELISA to detect Maize dwarf mosaic virus (MDMV) or Sugarcane mosaic virus (SCMV), which were endemic to this area (1). Only 2 out of 18 samples were positive for MDMV, SCMV, or mixed infection of both viruses. Sap inoculation tests conducted on seedlings of sweet corn cv. Honey 236 indicated that the MDMV- and SCMV-negative samples still had an unknown pathogen causing original symptoms in the receptor plants. The isolate from Yunlin county reacted only with the antibody to Maize chlorotic mottle virus (MCMV) (AC Diagnostics, Fayetteville, AR) in ELISA. For further identification, the MCMV-specific primers (forward: MCMVg3514F-GGGAACAACCTGCTCCA; reverse MCMVg4014R-GGACACGGAGTACGAGA) were designed from the nucleotide sequence of MCMV coat protein (CP) gene. In RT-PCR using the AccuPower RT/PCR PreMix kit (Bioneer, Daejeon, Korea), an expected 500-bp DNA fragment was observed. This PCR product was cloned and its nucleotide sequence was determined by Mission Biotech Co., Taipei, Taiwan. BLAST analysis of the CP gene of the MCMV-Yunlin revealed the maximum nucleotide identities (99%) with Chinese Sichuan isolates (GenBank Accession No. JQ984270) and 98% identities to four Chinese Yunnan isolates (GU138674, JQ982468, JQ982469, and KF010583) and one Kenya isolate (JX286709), compared with 97% to Kansas isolate (X14736) and 96% to Nebraska isolate (EU358605). Subsequently, the complete nucleotide sequence of the viral genome (KJ782300) was determined from five overlapping DNA fragments obtained from independent RT-PCR amplification. The virus isolate was infectious to sweet corn cultivars Bai-long-wang, Devotion, SC-34, SC2015, and Zheng-zi-mi, on which similar symptoms were developed after mechanical inoculation. During the spring of 2014, a total of 224 sweet corn samples were collected from the epidemic areas of Taichung, Yunlin, Chiayi, and Kaohsiung counties. Samples (n= 161) reacted positive for MCMV in ELISA and/or RT-PCR. In the field survey, more than 20 adult thrips might be observed on an MCMV-infected plant. Two species of Frankliniella were found on maize plants: F. williamsi Hood and F. intonsa Trybom. Maize thrips (F. williamsi), an occasional pest of maize occurring during winter and spring in Taiwan, was characterized by its abdominal sternite II on which 1 or 2 discal setae of equal length with posteromarginal setae were borne (2). Samples with 1, 5, 10, and 30 F. williamsi collected in the field were tested by RT-PCR; MCMV was detectable not only in the pooled crushed bodies but also in a single maize thrips. This is the first report of MCMV occurrence on maize in Taiwan and of the virus transmitted by maize thrips. References: (1) C. T. Chen et al. Taiwan Sugar 37(4):9, 1990. (2) C.-L. Wang et al. Zool. Stud. 49:824, 2010.

Visual detection of Maize chlorotic mottle virus by asymmetric polymerase chain reaction with unmodified gold nanoparticles as the colorimetric probe

2016 ◽  
Vol 8 (38) ◽  
pp. 6959-6964 ◽  
Author(s):  
Lin Wang ◽  
Zhanmin Liu ◽  
Xueying Xia ◽  
Junyi Huang
Keyword(s):  
Polymerase Chain Reaction ◽  
Visual Detection ◽  
Mottle Virus ◽  
Chain Reaction ◽  
Maize Seeds ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Asymmetric Polymerase Chain Reaction ◽  
Polymerase Chain

Maize chlorotic mottle virus causes corn lethal necrosis disease and can transmit via infected maize seeds.

scholarly journals First Report of Maize chlorotic mottle virus and Maize Lethal Necrosis in Kenya

Plant Disease ◽  
2012 ◽  
Vol 96 (10) ◽  
pp. 1582-1582 ◽  
Author(s):  
A. W. Wangai ◽  
M. G. Redinbaugh ◽  
Z. M. Kinyua ◽  
D. W. Miano ◽  
P. K. Leley ◽  
...  
Keyword(s):  
Mottle Virus ◽  
Streak Virus ◽  
Rt Pcr ◽  
First Report ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Varieties ◽  
Young Leaves ◽  
Symptomatic Leaf

In September 2011, a high incidence of a new maize (Zea mays L.) disease was reported at lower elevations (1,900 m asl) in the Longisa division of Bomet County, Southern Rift Valley, Kenya. The disease later spread to the Narok South and North and Naivasha Districts. By March 2012, the disease was reported at up to 2,100 m asl. Diseased plants had symptoms characteristic of virus diseases: a chlorotic mottle on leaves, developing from the base of young whorl leaves upward to the leaf tips; mild to severe leaf mottling; and necrosis developing from leaf margins to the mid-rib. Necrosis of young leaves led to a “dead heart” symptom, and plant death. Severely affected plants had small cobs with little or no grain set. Plants frequently died before tasseling. All maize varieties grown in the affected areas had similar symptoms. In these regions, maize is grown continuously throughout the year, with the main planting season starting in November. Maize streak virus was present, but incidence was low (data not shown). Infected plants were distributed throughout affected fields, with heavier infection along field edges. High thrips (Frankliniella williamsi Hood) populations were present in sampled fields, but populations of other potential disease vectors, such as aphids and leafhoppers, were low. Because of the high thrips populations and foliar symptoms, symptomatic plants were tested for the presence of Maize chlorotic mottle virus (MCMV) (3) using tissue blot immunoassay (TBIA) (1). Of 17 symptomatic leaf samples from each Bomet and Naivasha, nine from Bomet and all 17 from Naivasha were positive for MCMV. However, the observed symptoms were more severe than commonly associated with MCMV, suggesting the presence of maize lethal necrosis (MLN), a disease that results from maize infection with both MCMV and a potyvirus (4). Therefore, samples were tested for the presence of Sugarcane mosaic virus (SCMV), which is present in Kenya (2). Twenty-seven samples were positive for SCMV by TBIA, and 23 of 34 samples were infected with both viruses. Virus identities were verified with reverse-transcription (RT)-PCR (Access RT-PCR, Promega) and MCMV or SCMV-specific primers. MCMV primers (2681F: 5′-ATGAGAGCAGTTGGGGAATGCG and 3226R: 5′-CGAATCTACACACACACACTCCAGC) amplified the expected 550-bp product from three leaf samples. Amplicon sequences were identical, and had 95 to 98% identity with MCMV sequences in GenBank. SCMV primers (8679F: 5′-GCAATGTCGAAGAAAATGCG) and 9595R: 5′-GTCTCTCACCAAGAGACTCGCAGC) amplified the expected 900-bp product from four leaf samples. Amplicon sequences had 96 to 98% identity, and were 88 to 96% identical with SCMV sequences in GenBank. To our knowledge, this is the first report of MCMV and of maize coinfection with MCMV and SCMV associated with MLN in Kenya and Africa. MLN is a serious threat to farmers in the affected areas, who are experiencing extensive to complete crop loss. References: (1) P. G. S. Chang et al. J. Virol. Meth. 171:345, 2011. (2) Delgadillo Sanchez et al. Rev. Mex. Fitopat. 5:21, 1987. (3) Jiang et al., Crop Prot. 11:248, 1992. (4) R. Louie, Plant Dis. 64:944, 1980.

scholarly journals Detection of Diverse Maize Chlorotic Mottle Virus Isolates in Maize Seed

Plant Disease ◽  
2020 ◽  
Author(s):  
Pauline Bernardo ◽  
Timothy Frey ◽  
Kelly Barriball ◽  
Pierce Anderson Paul ◽  
Kristen Willie ◽  
...  
Keyword(s):  
Leaf Tissue ◽  
Diagnostic Methods ◽  
Mottle Virus ◽  
Diagnostic Assay ◽  
Rt Pcr ◽  
Maize Seed ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Seed Extracts

Maize chlorotic mottle virus (MCMV) has driven the emergence of maize lethal necrosis (MLN) worldwide, where it threatens maize production in areas of East Africa, South America, and Asia. It is thought that MCMV transmission through seed may be important for introduction of the virus in new regions. Identification of infested seed lots is critical for preventing the spread of MCMV through seed. Although methods for detecting MCMV in leaf tissue are available, diagnostic methods for its detection in seed lots are lacking. In this study, ELISA, RT-PCR, and RT-qPCR were adapted for detection of MCMV in maize seed. Purified virions of MCMV isolates from Kansas, Mexico and Kenya were then used to determine the virus detection thresholds for each diagnostic assay. No substantial differences in response were detected among the isolates in any of the three assays. The RT-PCR and a SYBRTM green-based RT-qPCR assays were >3,000 times more sensitive than commercial ELISA for MCMV detection. For ELISA using seed extracts, selection of positive and negative controls was critical, most likely because of relatively high backgrounds. Use of seed soak solutions in ELISA detected MCMV with similar sensitivity to seed extracts, produced minimal background, and required substantially less labor. ELISA and RT-PCR were both effective for detecting MCMV in seed lots from Hawaii and Kenya, with ELISA providing a reliable and inexpensive diagnostic assay that could be implemented routinely in seed testing facilities.

scholarly journals First Report of Maize chlorotic mottle virus Infecting Sugarcane (Saccharum officinarum)

Plant Disease ◽  
2014 ◽  
Vol 98 (4) ◽  
pp. 572-572 ◽  
Author(s):  
Q. Wang ◽  
X. P. Zhou ◽  
J. X. Wu
Keyword(s):  
Mosaic Virus ◽  
Yunnan Province ◽  
Saccharum Officinarum ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Total Rna ◽  
Chlorotic Mottle Virus ◽  
Maize Chlorotic Mottle Virus ◽  
Chlorotic Mottle ◽  
Maize Plants

The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (Saccharum officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants. References: (1) J.-X. Wu et al. J. Zhejiang Univ-Sci B (Biomed & Biotechnol). 14:555, 2013. (2) L. Xie et al. J. Phytopathol. 159:191, 2011.

Sign in / Sign up

Export Citation Format

Share Document