A distinct phoronid larva: morphological and molecular evidence

2013 ◽  
Vol 27 (6) ◽  
pp. 622 ◽  
Author(s):  
Elena N. Temereva ◽  
Tatiana V. Neretina
Keyword(s):  
Rrna Genes ◽  
Molecular Characteristics ◽  
Molecular Evidence ◽  
28S Rrna ◽  
Vostok Bay ◽  
Distinctive Features ◽  
Marine Communities ◽  
Close Relationship ◽  
Phoronopsis Harmeri ◽  
World Fauna

Phoronids can be a major component of benthic and planktonic marine communities. Currently, the phoronid world fauna includes ten recognised species, known from adults; however, at least 32 larval forms have been described or documented. This study examined the morphology and 18S rRNA and 28S rRNA genes of two phoronid larvae abundant in Vostok Bay, Sea of Japan. One type was identified as the larval stage of Phoronopsis harmeri, although some distinctive features of this larva differ from the typical description. The morphological and molecular characteristics of the other larva did not match those of described species. According to our morphological results, this second actinotroch larva belongs to the genus Phoronis, but differs morphologically and molecularly from all the known species in the genus, all of which are represented in GenBank for the markers employed here. Taken together, our data suggest that the second actinotroch larva belongs to an undescribed phoronid species. The adult form of this actinotroch has never been identified, but our data suggest a close relationship with Phoronis pallida. The existence of a putative new phoronid species is also confirmed by presence of competent phoronid larvae, which are found in different aquatic areas, have a unique set of morphological features, and whose belonging is still not established.

Morphologic and molecular characteristics of Sarcocystis atraii n. sp. (Apicomplexa: Sarcocystidae) infecting the common coot (Fulica atra) from Egypt

2015 ◽  
Vol 60 (4) ◽  
Author(s):  
Ahmed El-Morsey ◽  
Mahmoud El-Seify ◽  
Abdel-Razik Y. Desouky ◽  
Mohamed M. Abdel-Aziz ◽  
Khaled Mohamed El-Dakhly ◽  
...  
Keyword(s):  
Distinct Species ◽  
Rrna Genes ◽  
Ground Substance ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Structural Morphology ◽  
Transmission Electron ◽  
Fulica Atra ◽  
Morphologic Type ◽  
Species Being

AbstractA single morphologic type of Sarcocystis cysts found in two out of 43 examined common coots, Fulica atra, is considered to represent a new species for which the name Sarcocystis atraii n. sp. is proposed and its description is provided. Coots were hunted from the vicinity of Brolos Lake located at KafrElsheikh province, Egypt. The structural morphology of the revealed sarcocysts was described using light and transmission electron microscopy. Sarcocysts were found in the leg and thigh muscles. The cysts were microscopic and measured 165−850 μm in length × 50−85 μm in width. Histologically; the sarcocyst wall was wavy and had minute undulations. Ultrastructurally, it measured 1−3 μm in thickness and possessed many mushroom-like villar protrusions sometimes originating from other mushroom-like villar protrusions that measured approximately 0.5−2 μm in length and up to 2 μm in width, with the presence of electron dense ground substance of 300 nm to 1 μm thick. The bradyzoites were elongated, banana-shaped and measured 7.5−14 × 1.5−2.5 μm, with centrally or terminally located nuclei. The ultrastructural features of the cyst wall belonged to type 24. On the basis of sequencing and phylogenic analyses for 18S rRNA , 28S rRNA genes and ITS-1 region; S. atraii n. sp. is considered a genetically distinct species, being most closely related to avian Sarcocystis spp. whose definitive hosts are predatory mammals.

Systematic status of the caridean families Gnathophyllidae Dana and Hymenoceridae Ortmann (Crustacea : Decapoda): a preliminary examination based on nuclear rDNA sequences

2007 ◽  
Vol 21 (6) ◽  
pp. 613 ◽  
Author(s):  
M. Mitsuhashi ◽  
Y. W. Sin ◽  
H. C. Lei ◽  
T.-Y. Chan ◽  
K. H. Chu
Keyword(s):  
Phylogenetic Trees ◽  
18S Rrna ◽  
Rrna Genes ◽  
28S Rrna ◽  
Nuclear Rdna ◽  
Rdna Sequences ◽  
Preliminary Examination ◽  
The Family ◽  
Close Relationship ◽  
Paraphyletic Assemblage

The systematic positions of the caridean families Gnathophyllidae and Hymenoceridae are inferred based on analyses of nuclear 18S rRNA and 28S rRNA genes. The phylogenetic trees based on 18S rRNA and 28S rRNA from selected species of one genus of the family Gnathophyllidae, two genera of the family Hymenoceridae, one genus of the family Anchistioididae, eight genera of the subfamily Pontoniinae and five genera of the subfamily Palaemoninae show a close relationship between Hymenoceridae, Gnathophyllidae and Pontoniinae, with the last group constituting a paraphyletic assemblage. This result concurs with the morphology of maxilla in the first zoea, but not the shape of the third maxilliped in adults, based on which Gnathophyllidae and Hymenoceridae are treated as families. Molecular analysis supports the similarities in larval morphology between Hymenoceridae, Gnathophyllidae and Pontoniinae and therefore draws into question the familial status of the former two groups.

A New Zealand species of the trans-Tasman centipede order Craterostigmomorpha (Arthropoda : Chilopoda) corroborated by molecular evidence

2008 ◽  
Vol 22 (1) ◽  
pp. 1 ◽  
Author(s):  
Gregory D. Edgecombe ◽  
Gonzalo Giribet
Keyword(s):  
New Zealand ◽  
Species Diversity ◽  
16S Rrna ◽  
Malpighian Tubules ◽  
Rrna Genes ◽  
Molecular Evidence ◽  
28S Rrna ◽  
Long Distance ◽  
Geographic Structure ◽  
Coi Sequences

Craterostigmus tasmanianus Pocock, 1902, is the sole species in the centipede order Craterostigmomorpha and the focus of much phylogenetic research in Chilopoda. Originally named from Tasmania, Craterostigmus from New Zealand was first considered conspecific with Tasmanian samples based on external morphology, though recent anatomical studies have argued for a deep divergence between New Zealand and Tasmanian Craterostigmus, and a high-ranking taxonomic separation has been advocated. Unambiguous diagnostic nucleotide characters in nuclear ribosomal 18S and 28S rRNA genes as well as in the mitochondrial 16S rRNA, together with the significantly smaller size of New Zealand individuals, the arrangement of supernumerary Malpighian tubules, and patterns in leg spinosity, permit distinction of a New Zealand species, Craterostigmus crabilli, sp. nov. In addition, phylogenetic analysis of four markers (the aforementioned markers plus cytochrome c oxidase subunit I) suggests differentiation of C. tasmanianus from the New Zealand specimens. Combination of the nuclear ribosomal genes and mitochondrial 16S rRNA and COI sequences retrieves a geographic pattern within C. crabilli, sp. nov. in which geographic proximity is decoupled from closest affinities, although the 16S rRNA dataset alone shows more geographic structure. The genetic pattern observed, where among species diversity (for both mitochondrial markers) is equivalent to, or greater than, the within species diversity, is not consistent with a recent long-distance dispersal event, and a relictual Gondwanan distribution is the most plausible alternative.

Phylogeny of hymenolepidids (Cestoda: Cyclophyllidea) from mammals: sequences of 18S rRNA and COI genes confirm major clades revealed by the 28S rRNA analyses

2021 ◽  
Vol 95 ◽  
Author(s):  
B. Neov ◽  
G.P. Vasileva ◽  
G. Radoslavov ◽  
P. Hristov ◽  
D.T.J. Littlewood ◽  
...  
Keyword(s):  
Ribosomal Rna ◽  
18S Rrna ◽  
Phylogenetic Analyses ◽  
The Other ◽  
Rrna Genes ◽  
Host Switching ◽  
28S Rrna ◽  
Mitochondrial Cytochrome ◽  
Rapid Radiation ◽  
18S Rrna Genes

Abstract The aim of the study is to test a hypothesis for the phylogenetic relationships among mammalian hymenolepidid tapeworms, based on partial (D1–D3) nuclear 28S ribosomal RNA (rRNA) genes, by estimating new molecular phylogenies for the group based on partial mitochondrial cytochrome c oxidase I (COI) and nuclear 18S rRNA genes, as well as a combined analysis using all three genes. New sequences of COI and 18S rRNA genes were obtained for Coronacanthus integrus, C. magnihamatus, C. omissus, C. vassilevi, Ditestolepis diaphana, Lineolepis scutigera, Spasskylepis ovaluteri, Staphylocystis tiara, S. furcata, S. uncinata, Vaucherilepis trichophorus and Neoskrjabinolepis sp. The phylogenetic analyses confirmed the major clades identified by Haukisalmi et al. (Zoologica Scripta 39: 631–641, 2010): Ditestolepis clade, Hymenolepis clade, Rodentolepis clade and Arostrilepis clade. While the Ditestolepis clade is associated with soricids, the structure of the other three clades suggests multiple evolutionary events of host switching between shrews and rodents. Two of the present analyses (18S rRNA and COI genes) show that the basal relationships of the four mammalian clades are branching at the same polytomy with several hymenolepidids from birds (both terrestrial and aquatic). This may indicate a rapid radiation of the group, with multiple events of colonizations of mammalian hosts by avian parasites.

scholarly journals Molecular investigation of an outbreak associated with total parenteral nutrition contaminated with NDM-producing Leclercia adecarboxylata

2021 ◽  
Vol 21 (1) ◽  
Author(s):  
Elvira Garza-González ◽  
Paola Bocanegra-Ibarias ◽  
Eduardo Rodríguez-Noriega ◽  
Esteban González-Díaz ◽  
Jesús Silva-Sanchez ◽  
...  
Keyword(s):  
Comparative Genomics ◽  
Carbapenem Resistance ◽  
Clonal Diversity ◽  
Molecular Characteristics ◽  
Molecular Evidence ◽  
Carbapenem Resistant ◽  
Parental Nutrition ◽  
Genes Encoding ◽  
Main Lineage ◽  
Encoding Genes

Abstract Background This study aimed to determine the epidemiological, microbiological, and molecular characteristics of an outbreak of carbapenem-resistant Leclercia adecarboxylata in three hospitals associated with the unintended use of contaminated total parental nutrition (TPN). Methods For 10 days, 25 patients who received intravenous TPN from the same batch of a formula developed sepsis and had blood cultures positive for L. adecarboxylata. Antimicrobial susceptibility and carbapenemase production were performed in 31 isolates, including one from an unopened bottle of TPN. Carbapenemase-encoding genes, extended-spectrum β-lactamase–encoding genes were screened by PCR, and plasmid profiles were determined. Horizontal transfer of carbapenem resistance was performed by solid mating. Clonal diversity was performed by pulsed-field gel electrophoresis. The resistome was explored by whole-genome sequencing on two selected strains, and comparative genomics was performed using Roary. Results All 31 isolates were resistant to aztreonam, cephalosporins, carbapenems, trimethoprim/sulfamethoxazole, and susceptible to gentamicin, tetracycline, and colistin. Lower susceptibility to levofloxacin (51.6%) and ciprofloxacin (22.6%) was observed. All the isolates were carbapenemase producers and positive for blaNDM-1, blaTEM-1B, and blaSHV-12 genes. One main lineage was detected (clone A, 83.9%; A1, 12.9%; A2, 3.2%). The blaNDM-1 gene is embedded in a Tn125-like element. Genome analysis showed genes encoding resistance for aminoglycosides, quinolones, trimethoprim, colistin, phenicols, and sulphonamides and the presence of IncFII (Yp), IncHI2, and IncHI2A incompatibility groups. Comparative genomics showed a major phylogenetic relationship among L. adecarboxylata I1 and USDA-ARS-USMARC-60222 genomes, followed by our two selected strains. Conclusion We present epidemiological, microbiological, and molecular evidence of an outbreak of carbapenem-resistant L. adecarboxylata in three hospitals in western Mexico associated with the use of contaminated TPN.

DNA barcodes provide evidence for the independent origin of the cultivated silkworms Samia ricini and Samia cynthia

2021 ◽  
pp. 1-8
Author(s):  
J.-C. Huang ◽  
X.-Y. Li ◽  
Y.-P. Li ◽  
R.-S. Zhang ◽  
D.-B. Chen ◽  
...  
Keyword(s):  
Genetic Distance ◽  
Phylogenetic Relationship ◽  
Dna Barcode ◽  
Distinct Species ◽  
Coi Gene ◽  
Molecular Evidence ◽  
Dna Barcodes ◽  
Close Relationship ◽  
Molecular Phylogenetic ◽  
Phylogenetic Framework

Samia ricini (Wm. Jones) and Samia cynthia (Drury) (Lepidoptera: Saturniidae) have been used as traditional sources of food as well as silk-producing insects. However, the phylogenetic relationship between the two silkworms remains to be addressed. In this study, the mitochondrial cytochrome c oxidase subunit 1 (COI) gene sequences corresponding to DNA barcodes from 13 Samia species were analysed, and a DNA barcode-based phylogenetic framework for these Samia species was provided. Phylogenetic analysis showed that multiple individuals of a species could be clustered together. Our analysis revealed a close relationship among Samia yayukae Paukstadt, Peigler and Paukstadt, Samia abrerai Naumann and Peigler, Samia kohlli Naumann and Peigler, Samia naessigi Naumann and Peigler, Samia naumanni Paukstadt, Peigler and Paukstadt, and Samia kalimantanensis Paukstadt and Paukstadt. The mixed clustering relationship and low Kimura-2-parameter (K2P) genetic distance (0.006) between individuals of S. ricini and Samia canningi (Hutton) indicated that the cultivated silkworm S. ricini was derived from the non-cultivated silkworm S. canningi. The remote phylogenetic relationship and high K2P genetic distance (0.039) indicated that S. ricini and S. cynthia are distinct species, thus providing solid molecular evidence that they had entirely independent origins. The relationships between S. kalimantanensis and S. naumanni and between S. cynthia and Samia wangi Naumann and Peigler, as well as the potential cryptic species within S. abrerai were also discussed. This is the first study to assess the DNA barcodes of the genus Samia, which supplements the knowledge of species identification and provides the first molecular phylogenetic framework for Samia species.

Morphological and molecular characteristics of Bastiania sinensis sp. n., Tripyla aquatica Brzeski & Winiszewska-Ślipińska, 1993 and T. setifera Bütschli, 1873 (Nematoda: Triplonchida) from Shanxi Province, North China

Nematology ◽  
2021 ◽  
pp. 1-23
Author(s):  
Mei Na Liu ◽  
Yu Mei Xu ◽  
Zeng Qi Zhao ◽  
Jian Ming Wang
Keyword(s):  
North China ◽  
Large Subunit ◽  
Small Subunit ◽  
Rrna Genes ◽  
Shanxi Province ◽  
Molecular Characteristics ◽  
Separate Species ◽  
Using Data ◽  
First Time ◽  
Respective Species

Summary This paper describes a new species of Bastiania, presents a new record and redescribes a known species of Tripyla. These nematodes are all in the order Triplonchida and were collected from Shanxi Province, North China. Bastiania sinensis sp. n. is characterised by having the female with a relatively slender body 1049-1295 μm long, dorsally arcuate after heat relaxation, with outer labial setae and cephalic setae in a single circle, an oval amphid, 7-8 laterodorsal cervical setae scattered in the pharyngeal region, orthometamenes and pseudocoelomocytes present, tail conoid with a mucron 1-2 μm long, two pairs of caudal setae present, a = 58.1-75.5, b = 4.0-4.6, c = 12.7-19.7, c′ = 4.1-7.8 and V = 61.1-67.7. Males were not found. Tripyla aquatica is recorded for the first time from China, and is redescribed. Tripyla setifera has been reported from China but without a detailed description – now provided. In addition, phylogenetic relationships among the species were analysed using data from the near full length small subunit (SSU) and D2-D3 segments of large subunit (LSU) of rRNA genes. Bastiania sinensis sp. n. is monophyletic with the Bastiania sequences available in GenBank, but is on an independent branch supporting its status as a separate species; T. aquatica and T. setifera are monophyletically clustered with known Tripyla species and grouped together with sequences from their respective species.

scholarly journals First Report of Root-Knot Nematode Meloidogyne enterolobii on Sweet Potato in China

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 702-702 ◽  
Author(s):  
B. Gao ◽  
R. Y. Wang ◽  
S. L. Chen ◽  
X. H. Li ◽  
J. Ma
Keyword(s):  
Sweet Potato ◽  
Dna Sequences ◽  
Molecular Characteristics ◽  
28S Rrna ◽  
Storage Roots ◽  
Specific Primers ◽  
First Report ◽  
Meloidogyne Enterolobii ◽  
Meloidogyne Spp ◽  
Meloidogyne Sp

Sweet potato (Ipomoea batatas Lam.) is the fifth largest staple crop after rice, wheat, maize, and soybean in China. Sweet potato tubers were received from Zhanjiang, Guangdong Province, China, in June 2013 for research purposes. Upon inspection, the storage roots showed typical symptoms of being infected by root-knot nematodes, Meloidogyne spp.; the incidence of infection was 95%. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 32 females on average (n = 20). The perineal patterns of most female specimens (n = 10) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The second-stage juvenile had large and triangular lateral lips and broad, bluntly rounded tail tip. These morphological characteristics are similar to those reported in the original description of Meloidogyne enterolobii Yang & Eisenback (2). The 28S rRNA D2D3 expansion domain was amplified with primers MF/MR (GGGGATGTTTGAGGCAGATTTG/AACCGCTTCGGACTTCCACCAG) (1). The sequence obtained for this population (n = 5) of Meloidogyne sp. (GenBank Accession No. KF646797) was 100% identical to the sequence of M. enterolobii (JN005864). For further confirmation, M. incognita specific primers Mi-F/Mi-R (GTGAGGATTCAGCTCCCCAG/ACGAGGAACA TACTTCTCCGTCC), M. javanica specific primers Fjav/Rjav (GGTGCGCGATTGAACTGAGC/CAGGCCCTTCAGTGGAACTATAC), and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/ TCAGTTCAGGCAGGATCAACC) were used for amplification of the respective DNA sequences (1). The electrophoresis results showed a bright band (~200 bp) only in the lane with the M. enterolobii specific primers. Therefore, this population of Meloidogyne sp. on sweet potato was identified as M. enterolobii based on its morphological and molecular characteristics. M. enterolobii has been reported to infect more than 20 plant species from six plant families: Fabaceae, Cucurbitaceae, Solanaceae, Myrtaceae, Annonaceae, and Marantaceae (1). To our knowledge, this is the first report of M. enterolobii on a member of the Convolvulaceae in China. Refrences: (1) M. X. Hu et al. Phytopathol. 101:1270, 2011. (2) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

Systematic revision, diversity patterns and trophic ecology of the tropical Indo-West Pacific sea slug genus Phanerophthalmus A. Adams, 1850 (Cephalaspidea, Haminoeidae)

2018 ◽  
Vol 32 (6) ◽  
pp. 1336 ◽  
Author(s):  
Jennifer Austin ◽  
Terrence Gosliner ◽  
Manuel A. E. Malaquias
Keyword(s):  
Content Analysis ◽  
Molecular Phylogenetics ◽  
Trophic Ecology ◽  
Rrna Genes ◽  
28S Rrna ◽  
Gut Content Analysis ◽  
Gut Content ◽  
Central Pacific ◽  
Systematic Revision ◽  
West Pacific

Phanerophthalmus is a genus of Indo-West Pacific sea slugs inhabiting seagrass and coral reefs with up to now seven species currently recognised as valid. The goals of this study are to revise the systematics of Phanerophthalmus, infer its phylogeny and patterns of diversity, as well as study its diet. Morphology was combined with molecular phylogenetics based on two mitochondrial (cytochrome c oxidase subunit I, 16S rRNA) and one nuclear (28S rRNA) genes. Molecular species delimitation methods (ABGD, DISSECT) were employed to aid delimiting species. Diet was assessed by gut content analysis. Seventeen species were recognised, 10 of them new to science (P. albotriangulatum, sp. nov., P. anettae, sp. nov., P. batangas, sp. nov., P. boucheti, sp. nov., P. cerverai, sp. nov., P. lentigines, sp. nov., P. paulayi, sp. nov., P. purpura, sp. nov., P. rudmani, sp. nov., P. tibiricae, sp. nov.). Phanerophthalmus has its highest diversity in the Western Pacific where 13 species occur with a peak in the Coral Triangle (11 species; three only known from here). Diversity decreases towards the Central Pacific with five species and Indian Ocean/Red Sea with four species. Only two species are distributed across the Indo-West Pacific. Preliminary gut content analysis suggests these slugs feed on diatoms.

scholarly journals The differential expression of ribosomal 18S RNA paralog genes from the chaetognath Spadella cephaloptera

2007 ◽  
Vol 12 (4) ◽  
Author(s):  
Roxane-Marie Barthélémy ◽  
Michel Grino ◽  
Pierre Pontarotti ◽  
Jean-Paul Casanova ◽  
Eric Faure
Keyword(s):  
Physiological Role ◽  
Class Ii ◽  
Class I ◽  
Rrna Genes ◽  
Whole Body ◽  
Rrna Gene ◽  
28S Rrna ◽  
Cellular Functions ◽  
Intraindividual Variation ◽  
Spadella Cephaloptera

AbstractChaetognaths constitute a small marine phylum of approximately 120 species. Two classes of both 18S and 28S rRNA gene sequences have been evidenced in this phylum, even though significant intraindividual variation in the sequences of rRNA genes is unusual in animal genomes. These observations led to the hypothesis that this unusual genetic characteristic could play one or more physiological role(s). Using in situ hybridization on the frontal sections of the chaetognath Spadella cephaloptera, we found that the 18S Class I genes are expressed in the whole body, with a strong expression throughout the gut epithelium, whereas the expression of the 18S Class II genes is restricted to the oocytes. Our results could suggest that the paralog products of the 18S Class I genes are probably the “housekeeping” 18S rRNAs, whereas those of class II would only be essential in specific tissues. These results provide support for the idea that each type of 18S paralog is important for specific cellular functions and is under the control of selective factors.

Sign in / Sign up

Export Citation Format

Share Document