246 ASSOCIATION OF SINGLE NUCLEOTIDE POLYMORPHISMS WITHIN THE BOVINE HEAT SHOCK PROTEIN 70 GENE AND CALVING RATES

2010 ◽  
Vol 22 (1) ◽  
pp. 280
Author(s):  
C. Rosenkrans Jr ◽  
M. Roe ◽  
M. Brown ◽  
Z. Johnson ◽  
H. Brown ◽  
...  
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Plasma Concentrations ◽  
Pcr Amplification ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Julian Date ◽  
Forage System ◽  
Calving Rate

Heat shock proteins (Hsp) are induced by various stressors such as heat, cold, toxins, and oxygen deprivation. Our objective was to determine the relationship among polymorphisms in the Hsp70 gene, forage system, and calving rates. Genomic DNA for 77 cows was purified from the buffy coats of EDTA-treated whole blood. The cows were Angus (n = 20), Brahman (n = 26), and reciprocal crosses (n = 31). Cows were assigned to and remained on their respective forage system for the duration of the experiment (8 years). Forage systems were endophyte-infected toxic tall fescue (E+) or common bermudagrass (CB). Specific primers for bovine Hsp70 (HSP1778F: CGCTGGAGTCGTACGCCTTC; HSP2326R: CTTGGAAGTAAACAGAAACGGG) were used for PCR amplification of a 523-base segment (based on GenBank accession number U09861). The PCR product was sequenced in both directions. Seven single nucleotide polymorphisms (SNP) were identified, and they were located at base positions 1851 (n = 6), 1902 (n = 4), 1917 (n = 4), 1926 (n =4), 2033 (n = 20), 2087 (n = 6), and 2098 (n =4). Concentrations of Hsp70, Julian date, and lifetime calving rate were analyzed by ANOVA, with each SNP represented as the main effect in the model. Two SNP resulted in altered peptide sequences, also known as mis-sense mutations (1926, aspartic acid to glutamic acid, and 2033, glycine to alanine). Five unique haplotypes were deduced based on the SNP profile (GCGCGCT, GCGCCCT, ACGCGCT, GCGCGGT, GTTGGCA, respectively, for haplotype 1, 2, 3, 4, and 5). Plasma concentrations of Hsp70 were affected by an interaction (P < 0.05) between Hsp70 haplotype and forage system. Cows with haplotypes 4 and 5 consuming fescue had higher plasma Hsp70 concentrations than other cows (5.4, 5.1, 3.8, 5.1, 5.2, 5.1, 5.7, 4.2, 22.4, and 9 MSE 1.5 ng mL-1, respectively, for 1-5 CB and 1-5 E+). That same interaction tended (P < 0.09) to be associated with lifetime calving percentage. Cows with haplotype 4 consuming bermudagrass had the lowest calving rate (58%). These results suggest that the Hsp70 gene in cattle is polymorphic, and those polymorphisms are related to cattle fertility.

247 ASSOCIATIONS BETWEEN HEAT SHOCK PROTEIN 70 GENETIC POLYMORPHISMS AND CALVING RATES OF BRAHMAN-INFLUENCED COWS

2010 ◽  
Vol 22 (1) ◽  
pp. 281
Author(s):  
C. Rosenkrans Jr ◽  
A. Banks ◽  
S. Reiter ◽  
L. Starkey ◽  
M. Looper
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Genetic Polymorphisms ◽  
Heat Shock Protein 70 ◽  
Promoter Region ◽  
Hsp70 Gene ◽  
Nucleotide Polymorphisms ◽  
Hsp70 Promoter ◽  
Single Nucleotide

Stress proteins and their genetic polymorphisms have been associated with decreased male and female fertility. Our objectives were to 1) identify single nucleotide polymorphisms (SNP) located in the promoter region of the bovine heat shock protein 70 (Hsp70) gene and 2) evaluate associations between Hsp70 SNP and calving rates of multiparous Brahman-influenced cows (n = 99). Genomic DNA was extracted from the buffy coats of EDTA- treated whole blood. Primers HSP-Pro749F (GCCAGGAAACCAGAGACAGA) and HSP-Pro1268R (CCTACGCAGGAGTAGGTGGT) were used for PCR amplification of a 539-base segment of the bovine Hsp70 promoter (GenBank accession number M98823). Eleven single nucleotide polymorphisms were detected: 8 transitions (G1013A, n = 2; G1045A, n = 8; C1069T, n = 4; A1096G, n = 14; G1117A, n = 12; T1134C, n = 7; C1154G, n = 11; andT1204C, n = 56), 2 transversions (A1125C, n = 53; and G1128T, n = 51), and 1 deletion at base position 895 (n = 37). Within an SNP, calving percentages were compared by chi-square analysis. Concentrations of Hsp70 and Julian date were analyzed by ANOVA, with each SNP represented as the main effect in the model. Cows that were homozygous for the minor allele at both transversion (A1125C and G1128T) sites had lower (P < 0.05) calving rates when compared with cows that were homozygous for the primary allele (48 v. 75%). Homozygous and heterozygous deletion of cytosine at base 895 resulted in lower (P < 0.05) calving percentages than homozygous cytosine cows (8, 50, 82%; respectively). In addition, DD cows had the latest (P < 0.05) Julian calving date. Eighteen Hsp70 promoter haplotypes were deduced, and 7 of those haplotypes (n = 37) included the deletion at base 895. Thirty-two cows had the haplotype consistent with the sequence deposited at GenBank, and the remaining 30 cows had an SNP other than the deletion. Cows with the deletion haplotypes had greater (P < 0.05) serum Hsp70 concentrations and lower (P < 0.05) calving rates (5.1, 4.7, and 3.5 MSE 0.5 ng mL-1; and 35, 78, and 87%; respectively, for Deletion, No, and Yes). Furthermore, cows with the deletion haplotypes had the latest (P < 0.05) Julian calving date (85, 77, and 73 d, respectively, for Deletion, No, and Yes). Our results suggest that the promoter region of the bovine Hsp70 gene is polymorphic and might be useful in selecting cows with greater fertility.

scholarly journals Effects of Germline CYP2W1*6 and CYP2B6*6 Single Nucleotide Polymorphisms on Mitotane Treatment in Adrenocortical Carcinoma: A Multicenter ENSAT Study

Cancers ◽  
2020 ◽  
Vol 12 (2) ◽  
pp. 359 ◽  
Author(s):  
Barbara Altieri ◽  
Silviu Sbiera ◽  
Sabine Herterich ◽  
Silvia De Francia ◽  
Silvia Della Casa ◽  
...  
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Therapeutic Range ◽  
Adrenocortical Carcinoma ◽  
Plasma Concentrations ◽  
Response To Therapy ◽  
Blood Levels ◽  
Individual Response ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Group B

Mitotane is the only approved drug for advanced adrenocortical carcinoma (ACC) and no biomarkers are available to predict attainment of therapeutic plasma concentrations and clinical response. Aim of the study was to evaluate the suitability of cytochrome P450(CYP)2W1 and CYP2B6 single nucleotide polymorphisms (SNPs) as biomarkers. A multicenter cohort study including 182 ACC patients (F/M = 121/61) treated with mitotane monotherapy after radical resection (group A, n = 103) or in not completely resectable, recurrent or advanced disease (group B, n = 79) was performed. CYP2W1*2, CYP2W1*6, CYP2B6*6 and CYP2B6 rs4803419 were genotyped in germline DNA. Mitotane blood levels were measured regularly. Response to therapy was evaluated as time to progression (TTP) and disease control rate (DCR). Among investigated SNPs, CYP2W1*6 and CYP2B6*6 correlated with mitotane treatment only in group B. Patients with CYP2W1*6 (n = 21) achieved less frequently therapeutic mitotane levels (>14 mg/L) than those with wild type (WT) allele (76.2% vs 51.7%, p = 0.051) and experienced shorter TTP (HR = 2.10, p = 0.019) and lower DCR (chi-square = 6.948, p = 0.008). By contrast, 55% of patients with CYP2B6*6 vs. 28.2% WT (p = 0.016) achieved therapeutic range. Combined, a higher rate of patients with CYP2W1*6WT+CYP2B6*6 (60.6%) achieved mitotane therapeutic range (p = 0.034). In not completely resectable, recurrent or advanced ACC, CYP2W1*6 SNP was associated with a reduced probability to reach mitotane therapeutic range and lower response rates, whereas CYP2B6*6 correlated with higher mitotane levels. The association of these SNPs may predict individual response to mitotane.

scholarly journals MALDI-TOF Mass Spectrometry for Multiplex Genotyping of CYP2B6 Single-Nucleotide Polymorphisms

2007 ◽  
Vol 53 (1) ◽  
pp. 24-33 ◽  
Author(s):  
Julia K Blievernicht ◽  
Elke Schaeffeler ◽  
Kathrin Klein ◽  
Michel Eichelbaum ◽  
Matthias Schwab ◽  
...  
Keyword(s):  
Mass Spectrometry ◽  
Single Nucleotide Polymorphisms ◽  
Direct Sequencing ◽  
Plasma Concentrations ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Maldi Tof Ms ◽  
Hepatic Expression ◽  
Maldi Tof ◽  
Tof Ms

Abstract Background: CYP2B6 is a highly variable and polymorphic cytochrome P450 (CYP) enzyme involved in the biotransformation of an increasing number of drugs, including cyclophosphamide, bupropion, and the nonnucleosidic reverse transcriptase inhibitor efavirenz. Several nonsynonymous and promoter single-nucleotide polymorphisms (SNPs) in the CYP2B6 gene are associated with altered hepatic expression and function, which affect drug plasma concentrations. Methods: We used multiplex PCR to amplify relevant gene fragments while avoiding amplification of the CYP2B7P1 pseudogene. Polymorphic sites were analyzed by allele-specific primer extension followed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Method evaluation was performed on a panel of 287 genomic DNA samples previously genotyped by other methods. Results: Five multiplex assays were developed, comprising the following 15 SNPs: −82T→C (*22); 86G→C (R29T, *17); 136A→G (M46V, *11); 296G→A (G99E, *12); 415A→G (K139E, *8, *13); 419G→A (R140Q, *14); 516G→T (Q172H, *6, *7, *9, *13, *19, *20), 547G→A (V183I); 769G→A (D257N); 785A→G (K262R, *4, *6, *7, *13, *16, *19, *20); 983T→C (I328T, *16, *18); 1006C→T (R336C, *19); 1172T→A (I391N, *15); 1282C→A (P428T, *21); 1459C→T (R487C, *5, *7). In 9 DNA samples showing discrepant genotypes, correctness of the MALDI-TOF MS result was confirmed by direct sequencing. Conclusions: This genotyping method enabled sensitive, specific, accurate, and comprehensive determination of 15 relevant SNPs of CYP2B6. The assay design allows analysis of SNP subsets, incorporation of additional SNPs, and performance of high-throughput genotyping.

scholarly journals Influence of Single Nucleotide Polymorphisms on Rifampin Pharmacokinetics in Tuberculosis Patients

Antibiotics ◽  
2020 ◽  
Vol 9 (6) ◽  
pp. 307
Author(s):  
Levin Thomas ◽  
Sonal Sekhar Miraj ◽  
Mallayasamy Surulivelrajan ◽  
Muralidhar Varma ◽  
Chidananda S. V. Sanju ◽  
...  
Keyword(s):  
Vitamin D ◽  
Single Nucleotide Polymorphisms ◽  
Drug Transporters ◽  
Plasma Concentrations ◽  
Transcriptional Regulators ◽  
Hepatic Uptake ◽  
Nucleotide Polymorphisms ◽  
Metabolizing Enzymes ◽  
Single Nucleotide ◽  
Pathway Gene

Rifampin (RF) is metabolized in the liver into an active metabolite 25-desacetylrifampin and excreted almost equally via biliary and renal routes. Various influx and efflux transporters influence RF disposition during hepatic uptake and biliary excretion. Evidence has also shown that Vitamin D deficiency (VDD) and Vitamin D receptor (VDR) polymorphisms are associated with tuberculosis (TB). Hence, genetic polymorphisms of metabolizing enzymes, drug transporters and/or their transcriptional regulators and VDR and its pathway regulators may affect the pharmacokinetics of RF. In this narrative review, we aim to identify literature that has explored the influence of single nucleotide polymorphisms (SNPs) of genes encoding drug transporters and their transcriptional regulators (SLCO1B1, ABCB1, PXR and CAR), metabolizing enzymes (CES1, CES2 and AADAC) and VDR and its pathway regulators (VDR, CYP27B1 and CYP24A1) on plasma RF concentrations in TB patients on antitubercular therapy. Available reports to date have shown that there is a lack of any association of ABCB1, PXR, CAR, CES1 and AADAC genetic variants with plasma concentrations of RF. Further evidence is required from a more comprehensive exploration of the association of SLCO1B1, CES2 and Vitamin D pathway gene variants with RF pharmacokinetics in distinct ethnic groups and a larger population to reach conclusive information.

scholarly journals Single nucleotide polymorphisms of the heat shock protein 90 gene in varicocele-associated infertility

2005 ◽  
Vol 31 (3) ◽  
pp. 236-244 ◽  
Author(s):  
Pericles A. Hassun Filho ◽  
Agnaldo P. Cedenho ◽  
Samira B. Lima ◽  
Valdemar Ortiz ◽  
Miguel Srougi
Keyword(s):  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Heat Shock Protein ◽  
Heat Shock Protein 90 ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide

scholarly journals Screening for Single-Nucleotide Polymorphisms Using Branch Migration Inhibition in PCR-amplified DNA

2000 ◽  
Vol 46 (9) ◽  
pp. 1464-1470 ◽  
Author(s):  
Alla Lishanski
Keyword(s):  
Single Nucleotide Polymorphisms ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Dna Polymorphisms ◽  
Rapid Screening ◽  
Sequence Difference ◽  
Nucleotide Polymorphisms ◽  
Branch Migration ◽  
Single Nucleotide ◽  
Multiple Alleles

Abstract Background: New methods are required for the exploration of the human genome by discovering sequence variations. This study evaluated the performance of a new method for screening a large number of samples for several DNA polymorphisms. Methods: We used a homogeneous method based on inhibition of spontaneous branch migration by any sequence difference between two molecules of PCR-amplified DNA. A set of four PCR primers is required: a forward primer, either biotinylated or labeled with digoxigenin, and two reverse primers that share a priming domain but have different “tail” sequences at their 5′ ends. After PCR amplification, denaturation and reannealing of the single DNA strands produce doubly labeled cruciform structures, which dissociate by strand exchange. The presence of two different alleles in a sample causes complete inhibition of dissociation, and the association of biotin and digoxigenin is homogeneously detected using luminescent oxygen channeling immunoassay. Results: The 90 samples of the Human Variation Panel (Coriell Cell Repositories) were screened for nine known single-nucleotide polymorphisms (SNPs) and one 5-bp deletion. The average signal-to-background ratio varied from ∼10 to 20. The frequency of the predominant allele for different SNPs varied from 51% to 88% overall. For some SNPs, it varied among the nine ethnic groups, e.g., 25–85% (average, 51%) for one SNP. The average heterozygosity varied from 0.17 to 0.54 and as much as 0.2–0.9 (average, 0.54) for one of the SNPs. Conclusion: The method allows simple and rapid screening of a large number of samples for the presence of multiple alleles.

scholarly journals Discovery of Coding Genetic Variants Influencing Diabetes-Related Serum Biomarkers and Their Impact on Risk of Type 2 Diabetes

2015 ◽  
Vol 100 (4) ◽  
pp. E664-E671 ◽  
Author(s):  
Tarunveer Singh Ahluwalia ◽  
Kristine Højgaard Allin ◽  
Camilla Helene Sandholt ◽  
Thomas Hempel Sparsø ◽  
Marit Eika Jørgensen ◽  
...  
Keyword(s):  
Type 2 Diabetes ◽  
Heat Shock ◽  
Single Nucleotide Polymorphisms ◽  
Genetic Variants ◽  
Binding Protein ◽  
Nucleotide Polymorphisms ◽  
Single Nucleotide ◽  
Igf Binding ◽  
Igf Binding Protein

Context: Type 2 diabetes (T2D) prevalence is spiraling globally, and knowledge of its pathophysiological signatures is crucial for a better understanding and treatment of the disease. Objective: We aimed to discover underlying coding genetic variants influencing fasting serum levels of nine biomarkers associated with T2D: adiponectin, C-reactive protein, ferritin, heat shock 70-kDa protein 1B, IGF binding protein 1 and IGF binding protein 2, IL-18, IL-2 receptor-α, and leptin. Design and Participants: A population-based sample of 6215 adult Danes was genotyped for 16 340 coding single-nucleotide polymorphisms and were tested for association with each biomarker. Identified loci were tested for association with T2D through a large-scale meta-analysis involving up to 17 024 T2D cases and up to 64 186 controls. Results: We discovered 11 associations between single-nucleotide polymorphisms and five distinct biomarkers at a study-wide P &lt; 3.4 × 10−7. Nine associations were novel: IL18: BIRC6, RAD17, MARVELD2; ferritin: F5; IGF binding protein 1: SERPING1, KLKB, GCKR, CELSR2, and heat shock 70-kDa protein 1B: CFH. Three of the identified loci (CELSR2, HNF1A, and GCKR) were significantly associated with T2D, of which the association with the CELSR2 locus has not been shown previously. Conclusion: The identified loci influence processes related to insulin signaling, cell communication, immune function, apoptosis, DNA repair, and oxidative stress, all of which could provide a rationale for novel diabetes therapeutic strategies.

Sign in / Sign up

Export Citation Format

Share Document