scholarly journals First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in cucurbit crops in Alabama

Plant Disease ◽  
2021 ◽  
Author(s):  
Shaonpius Mondal ◽  
Laura L. Jenkins Hladky ◽  
Rebecca A Melanson ◽  
Raghuwinder Singh ◽  
Edward Sikora ◽  
...  
Keyword(s):  
Gulf Coast ◽  
Infected Plant ◽  
Fall Season ◽  
First Report ◽  
Foliar Symptoms ◽  
Polymerase Chain ◽  
Primer Sets ◽  
Gulf Coast Region ◽  
Whitefly Vector ◽  
Cucurbit Chlorotic Yellows Virus

During the summer and fall of 2020, foliar yellowing symptoms, including leaf mottle and interveinal yellowing with green veins were observed on several melon, squash, and cucumber plants in commercial fields in Alabama, USA. These foliar symptoms were similar to those caused by the whitefly-transmitted yellowing viruses, cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) (both genus Crinivirus, Closteroviridae). A total of 231 leaf samples showing yellowing, interveinal chlorosis, and mottling (e-Xtra 1, 2) were collected from individual plants from 25 commercial fields in Alabama (70 watermelon, 52 melon, 34 pumpkin, 50 squash, and 25 cucumber) during two sampling periods, June (spring/summer season) and October (fall season) 2020. Total RNA, extracted as described in Tamang et al. (2021), was used in reverse transcription polymerase chain reaction (RT-PCR) with primer sets designed to amplify portions of the CCYV and CYSDV RNA-dependent RNA polymerase (RdRp) genes encoded on RNA1 of these viruses (Mondal et al. 2021, submitted; Kavalappara et al., 2021). Single infections of either CYSDV or CCYV were found in 53 of 57 infected cucurbit samples (of 231 total plants), whereas both viruses were detected in four samples, all squash. In June 2020 near the end of the spring season, CYSDV was identified from 20 of 114 total cucurbit plants tested (17.5%), but CCYV was not identified from any plants. During the fall season, 37 of 117 plants (32%) tested positive for the presence of one or both criniviruses. Of the 37 virus-positive samples from the fall season, 26 were singly infected with CCYV (70%), seven were singly infected with CYSDV (19%), and four were infected with both CYSDV and CCYV (11%). The RdRp amplicon was sequenced from three CCYV-infected plants (2 squash; GenBank Accession No. MZ073347, MZ073348; 1 cucumber, MZ073349) and one CYSDV-infected plant (melon, MZ073350); the 857 nt sequenced portion of the CCYV RdRp gene was found to share 99% identity with the same sequence of CCYV RNA1 isolates from Israel (MH477611.1) and California (MW680157), whereas the 494 nt CYSDV amplicon shared 100% sequence identity with the comparable sequence from RNA1 of a CYSDV isolate from Arizona (EF547827.1). In addition, all of the CYSDV and CCYV infections were confirmed using a second set of primers that amplified 394 and 372 nt sections of the coat protein gene of each virus, respectively (Wintermantel et al., 2009; 2019), encoded on RNA2 of each viral genome. Furthermore, a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted) was used to confirm four representative CYSDV and CCYV infections each. This is the first report of CYSDV and CCYV in cucurbit crops from Alabama. Surprisingly, CYSDV was only found in melon plants (20 of 52, 38%), whereas CCYV was only found in squash, pumpkin, and cucumber (26 of 109, 24%); no watermelon plants were infected with either virus, even though watermelon is a known host of both viruses. The identification of CCYV and CYSDV in Alabama, along with a recent report of both criniviruses from nearby Georgia (Kavalappara et al., 2021) illustrates the need for a more thorough sampling of cucurbit crops, further monitoring of the whitefly vector, Bemisia tabaci, and the identification of alternate hosts of these viruses to better understand the epidemiology of these viruses in Alabama and throughout the Gulf Coast region.

First Report of Rhizoctonia Foliar Blight of Soybean in South Carolina

2006 ◽  
Vol 7 (1) ◽  
pp. 50
Author(s):  
M. R. Williamson ◽  
C. S. Rothrock ◽  
J. D. Mueller
Keyword(s):  
South Carolina ◽  
Microscopic Examination ◽  
Gulf Coast ◽  
Clemson University ◽  
Soybean Sample ◽  
First Report ◽  
Foliar Blight ◽  
The Us ◽  
Gulf Coast Region ◽  
Coast Region

Rhizoctonia foliar blight of soybean is found in tropical and subtropical areas worldwide. In the US, it is found mainly in the states of the Gulf Coast region. On 13 September, 2005, the Clemson University Plant Problem Clinic received a soybean sample from Florence County, SC showing severe foliar blight. The cultivars Northrup King 7325 and 76-L9 were affected. Hyphae typical of Rhizoctonia species were observed on the foliar lesions, and the genus was confirmed by microscopic examination. Accepted for publication 7 August 2006. Published 30 October 2006.

scholarly journals First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 421-421 ◽  
Author(s):  
N. W. Gauthier ◽  
J. Polashock ◽  
T. T. Veetil ◽  
R. R. Martin ◽  
J. Beale
Keyword(s):  
Nucleic Acid ◽  
Mosaic Disease ◽  
Rt Pcr ◽  
First Report ◽  
Ctab Method ◽  
Symptomatic Tissue ◽  
Polymerase Chain ◽  
Primer Sets ◽  
Negative Controls ◽  
Dtcs Quick Start

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5′-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.

scholarly journals First Report of Clover Yellow Edge and STRAWB2 Phytoplasmas in Strawberry in Maryland

Plant Disease ◽  
1999 ◽  
Vol 83 (11) ◽  
pp. 1072-1072 ◽  
Author(s):  
R. Jomantiene ◽  
J. L. Maas ◽  
E. L. Dally ◽  
R. E. Davis
Keyword(s):  
Dna Sequences ◽  
Infected Plant ◽  
Rrna Gene ◽  
16S Rrna Gene Sequences ◽  
Universal Primer ◽  
First Report ◽  
Chain Reactions ◽  
Polymerase Chain Reactions ◽  
Phytoplasma Infection ◽  
Polymerase Chain

Commercial strawberry (Fragaria × ananassa Duchesne) plants that were either chlorotic and severely stunted or exhibiting fruit phyllody were collected in Maryland. The plants were assessed for phytoplasma infection by nested polymerase chain reactions primed by phytoplasma universal primer pairs R16mF2/R1 and F2n/R2 (2) or P1/P7 (3) and F2n/R2 for amplification of phytoplasma 16S ribosomal (r) DNA (16S rRNA gene) sequences. Phytoplasma-characteristic 1.2-kbp DNA sequences were amplified from all diseased plants. No phytoplasma-characteristic DNAs were amplified from healthy plants. Restriction fragment length polymorphism patterns of rDNA digested with AluI, KpnI, HhaI, HaeIII, HpaII, MseI, RsaI, and Sau3A1 endonucleases indicated that chlorotic and stunted plants were infected by a phytoplasma that belonged to subgroup 16SrIII-B (clover yellow edge [CYE] subgroup) and that the plant exhibiting fruit phyllody was infected by a phytoplasma that belonged to subgroup 16SrI-K (STRAWB2 subgroup). The STRAWB2 phytoplasma was first reported from strawberry plants grown in Florida and characterized as representative of a new subgroup of the aster yellows group, 16SrI (3); this is the first report of this phytoplasma occurring in strawberry outside of Florida. A STRAWB2-infected plant produced phylloid fruits in two consecutive years of observation in the greenhouse; the plant previously had been field-grown in a breeder's evaluation plots in Beltsville, MD. The CYE phytoplasma was first experimentally transmitted by leafhopper to commercial strawberry and F. virginiana Duchesne in Ontario Canada (1); this is the first report of natural CYE phytoplasma infection of strawberry in Maryland. CYE phytoplasma-infected plants, representing ≈5% of the total number of plants of one advanced sselection, were located in a breeder's evaluation plots in Beltsville. References: (1) L. N. Chiykowski. Can. J. Bot. 54:1171, 1976. (2) D. E. Gunderson and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (3) R. Jomantiene et al. Int. J. Syst. Bacteriol. 48:269, 1998.

scholarly journals First report of cucurbit yellow stunting disorder virus and cucurbit chlorotic yellows virus in melon in the Central Valley of California

Plant Disease ◽  
2021 ◽  
Author(s):  
Shaonpius Mondal ◽  
Laura L. Jenkins Hladky ◽  
Patricia L. Fashing ◽  
James Donald McCreight ◽  
Thomas A Turini ◽  
...  
Keyword(s):  
Sonoran Desert ◽  
Central Valley ◽  
Fresno County ◽  
Total Rna ◽  
First Report ◽  
Production Region ◽  
Primer Sets ◽  
Biotype B ◽  
Rna And Dna ◽  
Cucurbit Chlorotic Yellows Virus

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F – 5’ AAGAGCGGCAGCTACAATAC 3’, CABYV RdRp-R – 5’ TGCCACATTCCGGTTCATAG 3’), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

Sign in / Sign up

Export Citation Format

Share Document