First Report of a New Phytoplasma Subgroup, 16SrIII-T, Associated with Decline Disease Affecting Sweet and Sour Cherry Trees in Lithuania

During July 2007, sweet (Prunus avium) and sour cherry (P. cerasus) trees exhibiting disease symptoms suggestive of possible phytoplasma infection were observed in a large orchard in the Kaunas Region of Lithuania. Samples of leaf tissue were collected from 13 sweet cherry trees that were affected by a decline disease (designated cherry decline, ChD) characterized by symptoms that included leaf reddening and premature leaf drop and two sour cherry trees exhibiting proliferation of branches and nonseasonal flowering. To assess the diseased trees for phytoplasma infection, DNA was extracted with a Genomic DNA Purification Kit (Fermentas, Vilnius, Lithuania) and used as template in nested PCRs, primed by phytoplasma universal primer pairs P1/P7 and R16F2n/R16R2 for amplification of 16S ribosomal (r) DNA sequences (1,2). The 1.2-kbp DNA sequences amplified from all 15 trees were subjected to restriction fragment length polymorphism (RFLP) analyses with AluI, MseI, KpnI, HhaI, HaeIII, HpaII, RsaI, HinfI, TaqI, Sau3AI, and BfaI. The collective profiles indicated that DNAs were derived from two different phytoplasmas. One of them, designated ChD phytoplasma, was found in 11 sweet cherry trees and two sour cherry trees and tentatively classified as a member of new subgroup designated 16SrIII-T in 16S rDNA RFLP group 16SrIII (X-disease phytoplasma group). It was observed that the ChD phytoplasma caused different symptoms in sweet and sour cherry. The amplified ChD phytoplasma 16S rDNA was cloned in Escherichia coli, sequenced, and the sequence deposited in the GenBank database (Accession No. FJ231728). The ChD phytoplasma 16S rDNA shared 98.4 and 98.6% sequence identity with the 16S rDNAs from stone fruit-infecting phytoplasmas associated with western X-disease (GenBank Accession No. L04682) and Canada X-disease (GenBank Accession No. L33733), respectively, indicating that the three strains are closely related. Interestingly, the ChD phytoplasma 16S rDNA shared 99.8% sequence identity with 16S rDNA from one operon (rrnB, GenBank Accession No. AF370120) from a phytoplasma previously found to be associated with dandelion virescence (DanVir) disease in Lithuania. The operon rrnA (GenBank Accession No. AF370119) shared 99.3% sequence identity (2). The high similarity of the ChD 16S rRNA gene sequence to that of DanVir rrnB suggests the possibility that ChD and DanVir may belong to a single phytoplasma species and that dandelion is possibly an alternate host of ChD phytoplasma. The other phytoplasma, found in two sweet cherry trees, was classified in subgroup 16SrI-B of 16S rDNA RFLP group 16SrI (‘Candidatus Phytoplasma asteris’ and related strains) and was designated cherry proliferation phytoplasma (GenBank Accession No. FJ231729). Thus, in Europe, cherry may be affected by diseases associated with phytoplasmas belonging to groups 16SrI, 16SrIII, 16SrX, and 16SrXII (3,4). The infections by diverse phytoplasma strains and species underscore the need for production of phytoplasma-free planting stock and for intensified research to reduce ecological and economic impacts of these phytoplasmas. References: (1) D. E. Gunderson and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) R. Jomantiene et al. Eur. J. Plant Pathol. 108:507, 2002. (3) S. Paltrinieri et al. Acta Hortic. 550:365, 2001. (4) D. Valiunas et al. J. Plant Pathol. 91:71. 2009.

Download Full-text

First Report of Clover Proliferation Phytoplasma in Strawberry

Plant Disease ◽

10.1094/pdis.1999.83.10.967c ◽

1999 ◽

Vol 83 (10) ◽

pp. 967-967 ◽

Cited By ~ 4

Author(s):

R. Jomantiene ◽

J. L. Maas ◽

E. L. Dally ◽

R. E. Davis ◽

J. D. Postman

Keyword(s):

Dna Sequences ◽

Rrna Gene ◽

Universal Primer ◽

Disease Symptoms ◽

First Report ◽

Chain Reactions ◽

Polymerase Chain Reactions ◽

Fragaria Virginiana ◽

Phytoplasma Infection ◽

Group 2

In 1996, diseased plants of Fragaria virginiana Duchesne were collected from a native population in Quebec, Canada, and sent to the National Clonal Germplasm Repository in Corvallis, OR, where grafting onto disease-free plants of F. chiloensis (L.) Duchesne (4) was performed. Plants of both species were sent to Beltsville, MD, for identification of a phytoplasma possibly associated with the disease symptoms of dwarfing and multibranching crowns. A phytoplasma was found in both species and characterized as the strawberry “multicipita” (SM) phytoplasma, which is representative of subgroup 16SrVI-B, a new subgroup of the clover proliferation (CP) group (2). In 1999, we observed commercial strawberry (Fragaria × ananassa Duchesne) plants collected in California and Maryland that were stunted and chlorotic or exhibited these symptoms in addition to small, distorted leaves. Infected F. × ananassa plants, as well as diseased F. virginiana and grafted F. chiloensis plants previously infected by the SM phytoplasma, were assessed for phytoplasma infection by nested polymerase chain reactions primed by phytoplasma universal primer pairs R16mF2/R1 and F2n/R2 (1) or P1/P7 (3) and F2n/R2 for amplification of phytoplasma 16S rDNA (16S rRNA gene) sequences. Phytoplasma-characteristic 1.2-kbp DNA sequences were amplified from all diseased plants. No DNA sequences were amplified from healthy plants. Restriction fragment length polymorphism patterns of rDNA digested with AluI, KpnI, HhaI, HaeIII, HinfI, HpaII, MseI, RsaI, and Sau3A1 endonucleases indicated that all plants were infected by a phytoplasma that belonged to subgroup 16SrVI-A (CP phytoplasma subgroup) and that diseased F. virginiana and grafted F. chiloensis plants were infected by both SM and CP. This is the first report of the CP phytoplasma, subgroup 16SrVI-A, infecting strawberry. This report also indicates that the occurrence of the CP phytoplasma in strawberry may be widespread in North America and that F. chiloensis, F. virginiana, and F. × ananassa plants are susceptible to infection by the CP phytoplasma. References: (1) D. E. Gunderson and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) R. Jomantiene et al. HortScience 33:1069, 1998. (3) R. Jomantiene et al. Int. J. Syst. Bacteriol. 48:269, 1998. (4) J. D. Postman et al. Acta Hortic. 471:25, 1998.

Download Full-text

First Report of Two Distinct Phytoplasma Species, ‘Candidatus Phytoplasma cynodontis’ and ‘Candidatus Phytoplasma asteris,’ Simultaneously Associated with Yellow Decline of Wodyetia bifurcata (Foxtail Palm) in Malaysia

Plant Disease ◽

10.1094/pdis-04-13-0412-pdn ◽

2013 ◽

Vol 97 (11) ◽

pp. 1504-1504 ◽

Cited By ~ 7

Author(s):

N. Naderali ◽

N. Nejat ◽

Y. H. Tan ◽

G. Vadamalai

Keyword(s):

16S Rdna ◽

Nested Pcr ◽

Rflp Analysis ◽

Rrna Gene ◽

Gene Sequences ◽

First Report ◽

White Leaf ◽

General Decline ◽

Pcr Products ◽

Plant Pathol

The foxtail palm (Wodyetia bifurcata), an Australian native species, is an adaptable and fast-growing landscape tree. The foxtail palm is most commonly used in landscaping in Malaysia. Coconut yellow decline (CYD) is the major disease of coconut associated with 16SrXIV phytoplasma group in Malaysia (1). Symptoms consistent with CYD, such as severe chlorosis, stunting, general decline, and death were observed in foxtail palms from the state of Selangor in Malaysia, indicating putative phytoplasma infection. Symptomatic trees loses their green and vivid appearance as a decorative and landscape ornament. To determine the presence of phytoplasma, samples were collected from the fronds of 12 symptomatic and four asymptomatic palms in September 2012, and total DNA was extracted using the CTAB method (3). Phytoplasma DNA was detected in eight symptomatic palms using nested PCR with universal phytoplasma 16S rDNA primer pairs, P1/P7 followed by R16F2n/R16R2 (2). Amplicons (1.2 kb in length) were generated from symptomatic foxtail palms but not from symptomless plants. Phytoplasma 16S rDNAs were cloned using a TOPO TA cloning kit (Invitrogen). Several white colonies from rDNA PCR products amplified from one sample with R16F2n/R16R2 were sequenced. Phytoplasma 16S rDNA gene sequences from single symptomatic foxtail palms showed 99% homology with a phytoplasma that causes Bermuda grass white leaf (AF248961) and coconut yellow decline (EU636906), which are both members of the 16SrXIV ‘Candidatus Phytoplasma cynodontis’ group. The sequences also showed 99% sequence identity with the onion yellows phytoplasma, OY-M strain, (NR074811), from the ‘Candidatus Phytoplasma asteris’ 16SrI-B subgroup. Sequences were deposited in the NCBI GenBank database (Accession Nos. KC751560 and KC751561). Restriction fragment length polymorphism (RFLP) analysis was done on nested PCR products produced with the primer pair R16F2n/R16R2. Amplified products were digested separately with AluI, HhaI, RsaI, and EcoRI restriction enzymes based on manufacturer's specifications. RFLP analysis of 16S rRNA gene sequences from symptomatic plants revealed two distinct profiles belonging to groups 16SrXIV and 16SrI with majority of the 16SrXIV group. RFLP results independently corroborated the findings from DNA sequencing. Additional virtual patterns were obtained by iPhyclassifier software (4). Actual and virtual patterns yielded identical profiles, similar to the reference patterns for the 16SrXIV-A and 16SrI-B subgroups. Both the sequence and RFLP results indicated that symptoms in infected foxtail palms were associated with two distinct phytoplasma species in Malaysia. These phytoplasmas, which are members of two different taxonomic groups, were found in symptomatic palms. Our results revealed that popular evergreen foxtail palms are susceptible to and severely affected by phytoplasma. To our knowledge, this is the first report of a mixed infection of a single host, Wodyetia bifurcata, by two different phytoplasma species, Candidatus Phytoplasma cynodontis and Candidatus Phytoplasma asteris, in Malaysia. References: (1) N. Nejat et al. Plant Pathol. 58:1152, 2009. (2) N. Nejat et al. Plant Pathol. J. 9:101, 2010. (3) Y. P. Zhang et al. J. Virol. Meth. 71:45, 1998. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2009.

Download Full-text

First Report of Cherry green ring mottle virus and Cherry necrotic rusty mottle virus in Sweet Cherry (Prunus avium) in Chile and South America

Plant Disease ◽

10.1094/pdis-01-13-0010-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1122-1122 ◽

Cited By ~ 3

Author(s):

N. Fiore ◽

A. Zamorano

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Sweet Cherry ◽

Mottle Virus ◽

Reference Sequence ◽

Nucleotide Identity ◽

Green Ring ◽

Sequence Identity ◽

Cp Gene ◽

Plant Pathol

Cherry green ring mottle virus (CGRMV) infects several Prunus species, while Cherry necrotic rusty mottle virus (CNRMV) has been detected mainly in sweet cherry. In Chile, sweet cherry represents one of the most valuable fruit crops, and the country is the main producer of cherries in the southern hemisphere. In October 2011, leaf samples were collected from 21 trees of cv. Bing in Libertador General Bernardo O'Higgins and Maule regions. Leaves of symptomatic plants showed brown angular necrotic spots, the center of which can drop out giving a shot-hole appearance. Total RNA was extracted by the silica capture method (1). Reverse transcription (RT)-PCR was carried out to test the presence of CGRMV and CNRMV using primer pairs GRM7950/GRM8316 (1), and DetCNR-F (TCCCACCTCAAGTCCTAGCAGAGA) / DetCNR-R (TCATTGCTAATTGCAAAATCCCA). Ten and six samples were tested positive for CGRMV and CNRMV, obtaining 366- and 333-bp fragments, respectively. Mixed infections occurred in five samples. Two sets of primer pairs were designed to amplify a region of the genome which includes the entire coat protein (CP) gene: CGRM-CPF (GGCTGATGAAGAATTTGA-GAAG) and CGRM-CPR (GAGTGGAATTGCAGGGGTTT), and CNRM-CPF (GAGTGTGTGTGAGCTTTCAAGTT) and CNRM-CPR (TTCGCCCCGTGTTGTAAAAC). Amplicons of the expected size of 828 bp (CGRMV) and 892 bp (CNRMV) were obtained from infected samples. Three amplicons for each virus were cloned into pGEM-T and three colonies per cloned fragment were sequenced in both directions. For CNRMV, Chilean isolates CP9754 (GenBank Accession No. KC432619) and CP9956N (KC432621) had 98% for nucleotide identity with isolate JK10 from India (FN546178), while isolate CP9879 (KC432620) had 97% of nucleotide identity. For CGRMV, Chilean isolate CP3359 (KC432616) had 98% identity with isolate HI17 from Poland (JX468873), while isolates CP9731 (KC432617) and CP9956G (KC432618) had 98% and 99% nucleotide identity with isolate ita7 (AF533161) from Italy, respectively. Nucleotide and amino acid sequence identity between Chilean isolates of CGRMV ranged between 94.5% and 99.3%, and from 97.8% to 99.2%, respectively. For Chilean isolates of CNRMV, sequence identity ranged between 98.0% and 98.5% (nucleotide), and from 98.6% to 98.9% (amino acid). Sequence analysis indicated that CGRMV isolates found in Chile belong to group II (3). Detection was confirmed by non-isotopic molecular hybridization. Riboprobes were designed on the basis of a consensus sequence of CP gene and labeled with digoxigenin (2); are complementary to the fragments located from the nucleotide 7415 to 7576 for CGRMV (reference sequence NC 001946.1), and 7475 to 7638 for CNRMV (reference sequence NC 002468.1). The cultivar Bing manifested symptoms only when infected by CNRMV. Results suggest that CNRMV is the cause of symptoms and yield loss observed in Bing, the most important cherry variety cultivated in Chile. To our knowledge, this is the first report of CGRMV and CNRMV infecting sweet cherry in South America. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) J. A Sánchez-Navarro et al. Plant Pathol. 47:780, 1998. (3) Y. P. Zhang et al. J. Plant. Pathol. 82:49, 2000.

Download Full-text

Occurrence and detection of lesser known viruses and phytoplasmas in stone fruit orchards in Poland

Folia Horticulturae ◽

10.2478/fhort-2013-0159 ◽

2010 ◽

Vol 22 (2) ◽

pp. 51-57 ◽

Cited By ~ 1

Author(s):

Mirosława Cieślińska ◽

Halina Morgaś

Keyword(s):

Sweet Cherry ◽

Sour Cherry ◽

Fruit Trees ◽

Stone Fruit ◽

Mottle Virus ◽

Green Ring ◽

Japanese Plum ◽

Fruit Orchards ◽

Leaf Virus ◽

Cherry Trees

Abstract A survey was carried out on 38 commercial and experimental stone fruit orchards located in major growing areas of stone fruit trees in Poland to determine the incidence of lesser known viruses and phytoplasmas. Leaf samples from 145 sweet cherry and 102 sour cherry trees were tested for Little cherry virus 1 (LChV-1), Little cherry virus 2 (LChV-2), Cherry green ring mottle virus (CGRMV), Cherry mottle leaf virus (CMLV), and Cherry necrotic rusty mottle virus (CNRMV) using RT-PCR. Sixty samples collected from peach and 20 apricot trees were also tested for CGRMV. Eleven out of 145 sweet cherry and three out of 102 sour cherry trees were infected by LChV-1. CGRMV was detected in 10 sweet cherry, four sour cherry, 14 peach and two apricot trees. No LChV-2, CMLV and CNRMV were detected in any of the tested trees. Phloem tissue from samples of shoots collected from 145 sweet cherry, 102 sour cherry, 128 peach, 37 apricot, five nectarine and 20 European as well as Japanese plum trees were tested for phytoplasmas. The nested PCR of the extracted DNA with universal and specific primer pairs showed the presence of phytoplasmas in six sweet cherry, three sour cherry, nine peach, four apricot, one nectarine and three Japanese plum trees. The RFLP patterns of 16S rDNA fragments after digestion with RsaI, MseI, AluI, and SspI endonucleases indicated that selected stone fruit trees were infected by two distinct phytoplasmas belonging to the apple proliferation group. The stone fruit trees infected by LChV-1, CGRMV and phytoplasmas were grown in orchards localised in all seven regions

Download Full-text

First Report of Clover Yellow Edge and STRAWB2 Phytoplasmas in Strawberry in Maryland

Plant Disease ◽

10.1094/pdis.1999.83.11.1072c ◽

1999 ◽

Vol 83 (11) ◽

pp. 1072-1072 ◽

Cited By ~ 8

Author(s):

R. Jomantiene ◽

J. L. Maas ◽

E. L. Dally ◽

R. E. Davis

Keyword(s):

Dna Sequences ◽

Infected Plant ◽

Rrna Gene ◽

16S Rrna Gene Sequences ◽

Universal Primer ◽

First Report ◽

Chain Reactions ◽

Polymerase Chain Reactions ◽

Phytoplasma Infection ◽

Polymerase Chain

Commercial strawberry (Fragaria × ananassa Duchesne) plants that were either chlorotic and severely stunted or exhibiting fruit phyllody were collected in Maryland. The plants were assessed for phytoplasma infection by nested polymerase chain reactions primed by phytoplasma universal primer pairs R16mF2/R1 and F2n/R2 (2) or P1/P7 (3) and F2n/R2 for amplification of phytoplasma 16S ribosomal (r) DNA (16S rRNA gene) sequences. Phytoplasma-characteristic 1.2-kbp DNA sequences were amplified from all diseased plants. No phytoplasma-characteristic DNAs were amplified from healthy plants. Restriction fragment length polymorphism patterns of rDNA digested with AluI, KpnI, HhaI, HaeIII, HpaII, MseI, RsaI, and Sau3A1 endonucleases indicated that chlorotic and stunted plants were infected by a phytoplasma that belonged to subgroup 16SrIII-B (clover yellow edge [CYE] subgroup) and that the plant exhibiting fruit phyllody was infected by a phytoplasma that belonged to subgroup 16SrI-K (STRAWB2 subgroup). The STRAWB2 phytoplasma was first reported from strawberry plants grown in Florida and characterized as representative of a new subgroup of the aster yellows group, 16SrI (3); this is the first report of this phytoplasma occurring in strawberry outside of Florida. A STRAWB2-infected plant produced phylloid fruits in two consecutive years of observation in the greenhouse; the plant previously had been field-grown in a breeder's evaluation plots in Beltsville, MD. The CYE phytoplasma was first experimentally transmitted by leafhopper to commercial strawberry and F. virginiana Duchesne in Ontario Canada (1); this is the first report of natural CYE phytoplasma infection of strawberry in Maryland. CYE phytoplasma-infected plants, representing ≈5% of the total number of plants of one advanced sselection, were located in a breeder's evaluation plots in Beltsville. References: (1) L. N. Chiykowski. Can. J. Bot. 54:1171, 1976. (2) D. E. Gunderson and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (3) R. Jomantiene et al. Int. J. Syst. Bacteriol. 48:269, 1998.

Download Full-text

Molecular Evidence for the Presence of Maize Bushy Stunt Phytoplasma in Corn in Brazil

Plant Disease ◽

10.1094/pdis.1997.81.8.957c ◽

1997 ◽

Vol 81 (8) ◽

pp. 957-957 ◽

Cited By ~ 7

Author(s):

I. P. Bedendo ◽

R. E. Davis ◽

E. L. Dally

Keyword(s):

16S Rdna ◽

Dna Sequences ◽

Dna Amplification ◽

Molecular Evidence ◽

Rrna Gene ◽

Chromosomal Dna ◽

Chain Reactions ◽

Leaf Reddening ◽

Corn Plants ◽

Maize Bushy Stunt Phytoplasma

Previously, electron microscopy revealed that the corn (Zea mays L.) disease characterized by stunting and leaf reddening and commonly known as “red stunt” in Brazil is associated with plant infection by an unidentified phytoplasma (formerly mycoplasmalike organism) (1). During recent years, corn production in Brazil has been seriously affected by the increasing prevalence of a disease exhibiting symptoms similar to those of “red stunt.” The present investigation was initiated to determine the possible association of a phytoplasma with the current disease problem and to attain definitive molecular identification of any associated phytoplasma. To detect the possible presence of a phytoplasma in diseased corn in Brazil, plants exhibiting symptoms of stunting and leaf reddening in the field in 1995 and 1996 were assayed for the presence of phytoplasma DNA sequences by the use of polymerase chain reactions (PCR). We used primer pairs R16mF2/R16mR1 and R16F2n/R16R2 in nested PCRs (2) to prime phytoplasma-universal amplification of 16S ribosomal (r) DNA. Oligonucleotide pair rpF1/rpR1 (3) was used to prime phytoplasma-universal amplification of ribosomal protein (rp) gene operon sequences. Phytoplasma identification was accomplished by restriction fragment length polymorphism (RFLP) analysis of amplified 16S rDNA and rp gene operon sequences. Primer pair MBS-F1/MBS-R1 (4) was used to prime amplification of a maize bushy stunt (MBS)-specific chromosomal DNA sequence. Preparation of template DNAs, PCR conditions, and RFLP analyses of PCR products were as previously described (2–4). DNA amplification was observed in all PCRs containing template DNAs derived from symptomatic plants, indicating phytoplasmal infection of corn in Brazil. No DNA amplification was observed in PCR containing template DNA from healthy control corn plants. Polymorphisms in amplified 16S rDNA were those characteristic of phytoplasmas classified in 16S rRNA gene group 16SrI, subgroup I-B, of which MBS phytoplasma is a member (3). Collective RFLP patterns of amplified rp gene operon sequences were similar or identical to those observed in parallel tests for a known reference strain of MBS phytoplasma, indicating that the Brazilian corn plants were infected by MBS phytoplasma. Amplification of MBS-characteristic DNA was observed in PCRs containing MBS-specific primer pair MBS-F1/MBS-R1 and DNA from diseased corn, confirming infection of the plants by MBS phytoplasma. This work provides the first firm evidence for association of maize bushy stunt phytoplasma with the current disease problem of corn in Brazil. References: (1) A. S. Costa et al. Rev. Soc. Bras. Fitopatol. Piracicaba 4:39, 1971. (2) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35: 144,1996. (3) D. E. Gundersen et al. Int. J. Syst. Bacteriol. 46:64, 1996. (4) N. A. Harrison et al. Plant Dis. 80:263, 1996.

Download Full-text

First Report of Cherry green ring mottle virus on Sweet Cherry in Poland

Plant Disease ◽

10.1094/pd-89-1363a ◽

2005 ◽

Vol 89 (12) ◽

pp. 1363-1363 ◽

Cited By ~ 3

Author(s):

B. Komorowska ◽

M. Cieślińska

Keyword(s):

Nucleotide Sequence ◽

Sweet Cherry ◽

Pcr Amplification ◽

Sour Cherry ◽

Mottle Virus ◽

Rt Pcr ◽

Green Ring ◽

Bacterial Vector ◽

Primer Sets ◽

Cherry Trees

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, infects several Prunus species including sweet cherry, sour cherry, ornamental cherry, peach, and apricot throughout North America and Europe. On sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Sweet cherry trees are symptomless hosts of CGRMV. During the 2004 growing season, 27 sour and sweet cherry trees were tested for the presence of CGRMV. RNA was isolated from leaves using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and then evaluated by reverse transcription-polymerase chain reaction (RT-PCR) amplification. Two primer sets, GRMV7956/GRMV8316 (1) and NCP5/NCP3 (2), were used for amplification of the CGRMV coat protein gene (807 bp) or its fragment (366 bp), respectively. The cDNA fragments were cloned into bacterial vector pCR 2.1-TOPO, sequenced and analyzed using the Lasergene (DNASTAR, Madison, WI) computer program. Nucleotide sequence of the C328 isolate (GenBank Accession No. AY841279) was compared with corresponding regions of published sequences of CGRMV isolates. The nucleotide sequence of this isolate was 98% identical to the Leb isolate (GenBank Accession No. AF533157) from sour cherry. The lowest similarity (80%) was between the CP sequences of isolate C328 and an isolate from apricot (GenBank Accession No. AY172334.1). Results of biological indexing on Prunus serrulata ‘Shirofugen’ and ‘Kwanzan’ confirmed the infection of ‘Star’ sweet cherry with CGRMV. The indicators showed leaf epinasty and necrosis of fragments of midrib or veins characteristic for CGRMV (2). The CGRMV infection of the indicators was confirmed using RT-PCR. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

Download Full-text

First Report of Paulownia Witches'-Broom Phytoplasma in China

Plant Disease ◽

10.1094/pdis-92-7-1134a ◽

2008 ◽

Vol 92 (7) ◽

pp. 1134-1134 ◽

Cited By ~ 8

Author(s):

H. N. Yue ◽

Y. F. Wu ◽

Y. Z. Shi ◽

K. K. Wu ◽

Y. R. Li

Keyword(s):

16S Rdna ◽

Sequence Data ◽

Rflp Analysis ◽

Shaanxi Province ◽

Economic Losses ◽

Rrna Gene ◽

First Report ◽

Ctab Method ◽

Phytoplasma Infection ◽

Total Dna

Paulownia witches'-broom (PaWB) is one of the most important diseases affecting Paulownia tomentosa trees in China. According to 2006 statistics, the disease has affected 880,000 ha of trees for timber production causing billions of dollars in economic losses. During the spring and summer of 2006, a survey was done in Shaanxi Province to confirm phytoplasma infection of paulownia trees exhibiting symptoms of witches'-broom, stunting, yellowing, and proliferating secondary shoots. Foliage samples were collected from 24 symptomatic and 8 symptomless paulownia plants in eight different production fields. Total DNA was extracted from 0.5 g of leaf midrib and stem phloem tissue with a modified cetyltrimethylammoniumbromide (CTAB) method (3). Resulting DNA extracts were analyzed by a nested PCR assay using phytoplasma 16S rRNA gene primer pairs R16mF2/R16mR1 followed by R16F2n/ R16R2 (1), which amplified a 1.4-kb and a 1.2-kb product, respectively, from symptomatic plants. Restriction fragment length polymorphism (RFLP) analysis of the nested 1.2-kb 16S rDNA products with AluI, MseI, HhaI, HpaI, RsaI, BfaI, HinfI, and TaqI endonuclease (2) indicated that all symptomatic plants were infected by a phytoplasma belonging to aster yellows group (16SrI) subgroup D (16SrI-D) phytoplasma strains. A 1.2-kb 16S rDNA sequence (GenBank Accession No. DQ851169) derived from representative strain PaWB-Shaanxi was identical (100%) to that of PaWB phytoplasma (L27033), a known subgroup 16SrI-D strain from Taiwan (2). The agreement between the RFLP analysis and sequence data confirms that PaWB from Shaanxi is a member of subgroup 16SrI-D. To our knowledge, this is the first report of PaWB disease being present in China and of its association with the 16SrI-D subgroup. References: (1) D. E. Gundersen and I.-M. Lee. Phytopathol. Mediterr. 35:144, 1996. (2) I.-M. Lee et al. Inst. J. Syst. Bacteriol. 48:1153, 1998. (3) Y. Qi et al. Biotechnol. Bull. 4:44, 2004.

Download Full-text

THE ISOLATION OF VERTICILLIUM IN BUDS AND PEDICELS OF PEACH, APRICOT AND CHERRY

Canadian Journal of Plant Science ◽

10.4141/cjps67-008 ◽

1967 ◽

Vol 47 (1) ◽

pp. 61-63 ◽

Cited By ~ 1

Author(s):

G. E. Woolliams

Keyword(s):

Verticillium Wilt ◽

Verticillium Dahliae ◽

Sweet Cherry ◽

Sour Cherry ◽

Early Spring ◽

Verticillium Dahliae Kleb ◽

Cherry Trees

Verticillium dahliae Kleb. was isolated from buds on terminal growth collected both in summer and early spring from peach and apricot trees affected with Verticillium wilt, and from buds on 2-year wood of diseased sweet cherry trees. The fungus was recovered rarely from fruit pedicels of diseased sweet and sour cherry trees and not from those of diseased peach and apricot trees. Although transmission of the fungus to healthy trees by budding was not achieved, the possibility makes it prudent to use budwood from healthy trees only.

Download Full-text

Studies of rootstocks for stone fruit breeds (sweet cherry) in the condition of Hissar valley in Tajikistan

Agricultural Technologies ◽

10.35599/agritech/01.04.05 ◽

2019 ◽

Vol 1 (4) ◽

pp. 28-34

Author(s):

Rahima I. Ismoilova ◽

Sodzhida D. Umarova

Keyword(s):

Sweet Cherry ◽

Sour Cherry ◽

High Specificity ◽

Stone Fruit ◽

Wild Cherry ◽

Phenological Observation ◽

Entire Observation Period ◽

The Individual ◽

Leaf System ◽

Observation Period

This paper is about studying the rootstocks for stone fruit breeds (sweet cherry) in condition of Hissar valley in Tajikistan. Each type of rootstock has its own biological characteristics and imposes specific requirements for growing and development, both during reproduction in the mother plantation and during the growth of trees. For example, the root system in sour cherry is more superficial that of wild sweet cherry. Therefore, the care of trees grafted on sour cherry and wild cherry and of mother plantation bushes of these rootstocks cannot be same. Besides, there are very significant differences among the individual groups of rootstocks. Wild cherry, Mahaleb cherry and Lubskaya cherry are used as rootstocks in the conditions of the Hissar Valley in Tajikistan. High specificity of sweet cherry cultivar varieties depends on the rootstocks. Phenological observation were carried out in our experiments during years 2013-2018 in order to study their winter resistance, yield capacity and fruit quality. The same care for root and grafted plants was carried out during the entire observation period. At the same time a certain ratio between the leaf system of the rootstock and the graft was maintained by trimming the crown. As a result of the evolution and selection, we have identified the wild cherry forms which are distinguished by the highest yields. The most valuable cultivar varieties are Napoleon cherry and Bagration cherry. Compotes made of these varieties have received high evaluation in tasting.

Download Full-text