scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

scholarly journals First Report of Neofusicoccum mediterraneum and N. australe Causing Decay in Vitis vinifera in Castilla y León, Spain

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 876-876 ◽  
Author(s):  
M. T. Martin ◽  
L. Martin ◽  
M. J. Cuesta
Keyword(s):  
Elongation Factor ◽  
Morphological Characteristics ◽  
Genetic Identity ◽  
Malt Extract ◽  
Koch’S Postulates ◽  
First Report ◽  
Castilla Y Leon ◽  
Agar Plug ◽  
Koch's Postulates ◽  
Β Tubulin

During a survey for grapevine decline, five young grapevines (cvs. Tempranillo and Viura) with low vigor and reduced foliage were collected (June and August 2009). Fungal isolations were performed from vascular and brown wood. Small pieces of brown wood were placed onto malt extract agar supplemented with 0.25 g/liter of chloramphenicol and incubated at 25°C in darkness. Five resulting colonies were transferred to potato dextrose agar (PDA). Isolates were characterized by abundant, gray, aerial mycelium that reached a radius of 45 mm after 4 days. Pycnidia induced on water agar with pine needles and UV light contained conidia that were hyaline, smooth, thin walled, fusiform, (20-) 22 to 26 (-28) × (5.5-) 6 (-6.5) μm, with granular cytoplasm. On the basis of morphological characteristics Neofusicoccum mediterraneum was suspected (1). Single-conidial cultures were generated from each isolate. DNA analyses were described in Martin and Cobos (2). Sequences of the internal transcribed spacer (ITS) region confirmed the identification and revealed 99% genetic identity with N. mediterraneum (GenBank Accession No EU040221). A sequence of the ITS fragment was deposited with Accession No. JF437919. Partial sequences of β-tubulin and 1-α elongation factor genes were amplified and deposited in the GenBank with Accession Nos. JF437921 and JF437923, showing 100 and 99% similarity to Accession Nos. GU292786 and GU251350, respectively. Pathogenicity tests were conducted with two isolates. The inoculations were carried out on a fresh wound on which an agar plug was applied; on 110R-rootstock woods of 12 young vines with N. mediterraneum and 12 other control plants were treated with agar only. Grapevines were maintained in a greenhouse at 20 to 25°C. After 4 months, N. mediterraneum was reisolated from vascular and brown tissues in 92% of inoculated plants, fulfilling Koch's postulates. Control plants were asymptomatic and N. mediterraneum was not recovered. With the same methodology, isolate Y264-21-1 reached a radius of 43 mm after 4 days at 25°C on PDA, presented colonies becoming olivaceous with a moderately dense mycelia, mat in center, and aerial around. Conidia were hyaline, fusiform, base subtruncate (19-) 23 to 26 (-31) × 5 to 6 (7.5) μm, unicellular, and smooth with granular contents. Based on these descriptions, N. australe was suspected (3). ITS sequence comparison revealed 99% genetic identity with N. australe (Accession No. FJ150697), a sequence of the fragment was deposited with Accession No. JF437920. Partial sequences of β-tubulin and 1α-elongation factor were deposited in the GenBank (Accession Nos. JF437922 and JF437924) showing 100 and 99% similarity to Accession Nos. AY615149 and GU251352, respectively. Koch's postulates were completed as described above. After 4 months, N. australe was reisolated from internal brown lesions in 92% of inoculated plants. Control plants were asymptomatic and N. australe was not recovered. The streaking length average from inoculation point for N. mediterraneum was 42 ± 22 mm and 53 ± 7 mm for N. australe. To our knowledge this is the first report of N. mediterraneum and N. australe in Castilla y León (Spain). References: (1) P. W. Crous et al. Fungal Planet 19:2, 2007. (2) M. T. Martin and R. Cobos. Phytopathol. Mediterr. 46:18, 2007. (3) B. Slippers et al. Mycologia 96:1030, 2004.

scholarly journals First Report of Black Stem of Avicennia marina Caused by Fusarium equiseti in China

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 843-843 ◽  
Author(s):  
N.-H. Lu ◽  
Q.-Z. Huang ◽  
H. He ◽  
K.-W. Li ◽  
Y.-B. Zhang
Keyword(s):  
Morphological Characteristics ◽  
Its Region ◽  
Avicennia Marina ◽  
Optical Microscope ◽  
Ethanol Solution ◽  
Morphological Observation ◽  
Fusarium Equiseti ◽  
First Report ◽  
Initial Symptoms ◽  
Β Tubulin

Avicennia marina is a pioneer species of mangroves, a woody plant community that periodically emerges in the intertidal zone of estuarine regions in tropical and subtropical regions. In February 2013, a new disease that caused the stems of A. marina to blacken and die was found in Techeng Island of Zhanjiang, Guangdong Province, China. Initial symptoms of the disease were water-soaked brown spots on the biennial stems that coalesced so whole stems browned, twigs and branches withered, leaves defoliated, and finally trees died. This disease has the potential to threaten the ecology of the local A. marina community. From February to May 2013, 11 symptomatic trees were collected in three locations on the island and the pathogen was isolated as followed: tissues were surface disinfected with 75% ethanol solution (v/v) for 20 s, soaked in 0.1% mercuric chloride solution for 45 s, rinsed with sterilized water three times, dried, placed on potato dextrose agar (PDA), and incubated for 3 to 5 days at 28°C without light. Five isolates (KW1 to KW5) with different morphological characteristics were obtained, and pathogenic tests were done according Koch's postulates. Fresh wounds were made with a sterile needle on healthy biennial stems of A. marina, and mycelial plugs of each isolate were applied and covered with a piece of wet cotton to maintain moisture. All treated plants were incubated at room temperature. Similar symptoms of black stem were observed only on the stems inoculated the isolate KW5 after 35 days, while the control and all stems inoculated with the other isolates remained symptomless. An isolate similar to KW5 was re-isolated from the affected materials. The pathogenic test was repeated three times with the same conditions and it was confirmed that KW5 was the pathogen causing the black stem of A. marina. Hyphal tips of KW5 were transferred to PDA medium in petri dishes for morphological observation. After 48 to 72 h, white, orange, or brown flocculence patches of KW5 mycelium, 5.0 to 6.0 cm in diameter, grew. Tapering and spindle falciform macroconidia (11 to 17.3 μm long × 1.5 to 2.5 μm wide) with an obviously swelled central cell and narrow strips of apical cells and distinctive foot cells were visible under the optical microscope. The conidiogenous cells were intertwined with mycelia and the chlamydospores were globose and formed in clusters. These morphological characteristics of the isolate KW5 are characteristic of Fusarium equiseti (1). For molecular identification, the ITS of ribosomal DNA, β-tubulin, and EF-1α genes were amplified using the ITS4/ITS5 (5), T1/T2 (2), and EF1/EF2 (3) primer pairs. These sequences were deposited in GenBank (KF515650 for the ITS region; KF747330 for β-tubulin region, and KF747331 for EF-1α region) and showed 98 to 99% identity to F. equiseti strains (HQ332532 for ITS region, JX241676 for β-tubulin gene, and GQ505666 for EF-1α region). According to both morphological and sequences analysis, the pathogen of the black stem of A. marina was identified as F. equiseti. Similar symptoms on absorbing rootlets and trunks of A. marina had been reported in central coastal Queensland, but the pathogen was identified as Phytophthora sp. (4). Therefore, the disease reported in this paper differs from that reported in central coastal Queensland. To our knowledge, this is the first report of black stems of A. marina caused by F. equiseti in China. References: (1) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual, 1st ed. Wiley-Blackwell, Hoboken, NJ, 2006. (2) K. O'Donnell and E. Cigelnik. Mol. Phylogenet. Evol. 7:103, 1997. (3) K. O'Donnell et al. Proc. Natl. Acad. Sci. USA. 95:2044, 1998. (4) K. G. Pegg. Aust et al. Plant Pathol. 3:6, 1980. (5) A. W. Zhang et al. Plant Dis. 81:1143, 1997.

scholarly journals First Report of Multiple Species of the Botryosphaeriaceae Causing Bot Canker Disease of Indian Laurel-Leaf Fig in California

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 459-459 ◽  
Author(s):  
J. S. Mayorquin ◽  
A. Eskalen ◽  
A. J. Downer ◽  
D. R. Hodel ◽  
A. Liu
Keyword(s):  
Los Angeles ◽  
Fungal Pathogens ◽  
Southern California ◽  
Morphological Characteristics ◽  
Vascular Lesion ◽  
Site Location ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Nattrassia Mangiferae ◽  
Β Tubulin

Indian laurel-leaf fig (Ficus microcarpa L.) is a commonly used indoor and outdoor ornamental tree. F. microcarpa is most frequently encountered as lining city streets, especially in warmer southern California climates. A disease known as ‘Sooty Canker,' caused by the fungus Nattrassia mangiferae (Syd. & P. Syd) B. Sutton & Dyko, is particularly devastating on F. microcarpa. Disease symptoms are characterized by branch dieback, crown thinning, and if the disease progresses to the trunk, eventual tree death (2). Recent taxonomic revisions have renamed Nattrassia mangiferae as Neofusicoccum mangiferae (Syd. & P. Syd.) Crous, Slippers & A. J. L. Phillips (1). An initial survey conducted during the spring of 2011 across four cities in Los Angeles County included, Culver City, Lakewood, Santa Monica, and Whittier. Five symptomatic branches per city were collected from trees showing branch cankers and dieback. Pieces of symptomatic tissue (2 mm2) were plated onto one-half-strength potato dextrose agar. Most isolates initially identified by morphological characteristics, such as growth pattern, speed of growth, and colony color, resembled those in the Botryosphaeriaceae (4). Two representative isolates from each site location were sequenced. Sequences obtained from amplification of the internal transcribed spacer region (ITS1-5.8rDNA-ITS2) and the β-tubulin gene were compared in a BLAST search in GenBank. Results identified isolates as Botryosphaeria dothidea (identity of 99% to EF638767 and 100% to JN183856.1 for ITS and β-tubulin, respectively); Neofusicoccum luteum (100% to EU650669 and 100% to HQ392752); N. mediterraneum (100% to HM443605 and 99% to GU251836); and N. parvum (100% to GU188010 and 100% to HQ392766) and have been deposited in GenBank with the following accession numbers: JN543668 to JN543671 (ITS) and JQ080549 to JQ080552 (β-tubulin). Pathogenicity tests were conducted in the greenhouse on 6-month-old F. microcarpa with one isolate from each previously listed fungal species. Five plants per isolate were stem-wound inoculated with mycelial plugs and wrapped with Parafilm. Uncolonized agar plugs were used as a control. Inoculations were later repeated a second time in the same manner for a total of 10 plants per isolate. Plants were observed for 6 weeks and destructively sampled to measure vascular lesion lengths. Mean vascular lesion lengths were 26, 22, 54, and 46 mm for B. dothidea, N. luteum, N. mediterraneum, and N. parvum, respectively. The mean lesion lengths for all isolates were significantly different (P = 0.05) from the control. Each species was consistently recovered from inoculated plants, except the control, thus fulfilling Koch's postulates. To our knowledge, this is the first report on the pathogenicity of multiple Botryosphaeriaceae species causing branch canker and dieback on F. microcarpa in California. These results are significant since trees along sidewalks in southern California are often crowded and undergo extensive root and branch pruning and some Botryosphaeriaceae spp. are known to enter its host through wounds caused by pruning or mechanical injury (2,3). Further sampling is imperative to better assess the distribution of these canker-causing fungal pathogens on F. microcarpa. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) D. R. Hodel et al. West. Arborist 35:28, 2009. (3) V. McDonald et al. Plant Dis. 93:967, 2009. (4) B. Slippers et al. Fungal Biol. Rev. 21:90, 2007.

scholarly journals First Report of Fusarium Maize Ear Rot Caused by Fusarium kyushuense in China

Plant Disease ◽  
2014 ◽  
Vol 98 (2) ◽  
pp. 279-279 ◽  
Author(s):  
J.-H. Wang ◽  
H.-P. Li ◽  
J.-B. Zhang ◽  
B.-T. Wang ◽  
Y.-C. Liao
Keyword(s):  
Fusarium Species ◽  
Morphological Characteristics ◽  
Distilled Water ◽  
Ear Rot ◽  
Tubulin Gene ◽  
Average Growth ◽  
First Report ◽  
Maize Ear Rot ◽  
Maize Ear ◽  
Β Tubulin

From September 2009 to October 2012, surveys to determine population structure of Fusarium species on maize were conducted in 22 provinces in China, where the disease incidence ranged from 5 to 20% in individual fields. Maize ears with clear symptoms of Fusarium ear rot (with a white to pink- or salmon-colored mold at the ear tip) were collected from fields. Symptomatic kernels were surface-sterilized (1 min in 0.1% HgCl2, and 30 s in 70% ethanol, followed by three rinses with sterile distilled water), dried, and placed on PDA. After incubation for 3 to 5 days at 28°C in the dark, fungal colonies displaying morphological characteristics of Fusarium spp. (2) were purified by transferring single spores and identified to species level by morphological characteristics (2), and DNA sequence analysis of translation elongation factor-1α (TEF) and β-tubulin genes. A large number of Fusarium species (mainly F. graminearum species complex, F. verticillioides, and F. proliferatum) were identified. These Fusarium species are the main causal agents of maize ear rot (2). Morphological characteristics of six strains from Anhui, Hubei, and Yunnan provinces were found to be identical to those of F. kyushuense (1), which was mixed with other Fusarium species in the natural infection in the field. Colonies grew fast on PDA with reddish-white and floccose mycelia. The average growth rate was 7 to 9 mm per day at 25°C in the dark. Reverse pigmentation was deep red. Microconidia were obovate, ellipsoidal to clavate, and 5.4 to 13.6 (average 8.8) μm in length. Macroconidia were straight or slightly curved, 3- to 5-septate, with a curved and acute apical cell, and 26.0 to 50.3 (average 38.7) μm in length. No chlamydospores were observed. Identity of the fungus was further investigated by sequence comparison of the partial TEF gene (primers EF1/2) and β-tubulin gene (primers T1/22) of one isolate (3). BLASTn analysis of the TEF amplicon (KC964133) and β-tubulin gene (KC964152) obtained with cognate sequences available in GenBank database revealed 99.3 and 99.8% sequence identity, respectively, to F. kyushuense. Pathogenicity tests were conducted twice by injecting 2 ml of a prepared spore suspension (5 × 105 spores/ml) into maize ears (10 per isolate of cv. Zhengdan958) through silk channel 4 days post-silk emergence under field conditions in Wuhan, China. Control plants were inoculated with sterile distilled water. The ears were harvested and evaluated 30 days post-inoculation. Reddish-white mold was observed on inoculated ears and the infected kernels were brown. No symptoms were observed on water controls. Koch's postulates were fulfilled by re-isolating the pathogen from infected kernels. F. kyushuense, first described on wheat in Japan (1), has also been isolated from rice seeds in China (4). It was reported to produce both Type A and Type B trichothecene mycotoxins (1), which cause toxicosis in animals. To our knowledge, this is the first report of F. kyushuense causing maize ear rot in China and this disease could represent a serious risk of yield losses and mycotoxin contamination in maize and other crops. The disease must be considered in existing disease management practices. References: (1) T. Aoki and K. O'Donnell. Mycoscience 39:1, 1998. (2) J. F. Leslie and B. A. Summerell. The Fusarium Laboratory Manual. Blackwell Publishing, Ames, IA, 2006. (3) F. Van Hove et al. Mycologia 103:570, 2011. (4) Z. H. Zhao and G. Z. Lu. Mycotaxon 102:119, 2007.

scholarly journals First Report of Dieback on Hybrid Rhododendrons Caused by Neofusicoccum luteum and N. parvum in Spain

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 221-221 ◽  
Author(s):  
C. Pintos Varela ◽  
V. Redondo Fernández ◽  
J. P. Mansilla Vázquez ◽  
O. Aguín Casal
Keyword(s):  
Dna Sequences ◽  
Uv Light ◽  
Morphological Characteristics ◽  
Phytophthora Ramorum ◽  
Malt Extract ◽  
First Report ◽  
Agar Plug ◽  
Thin Walled ◽  
Neofusicoccum Luteum

During the conducting of Phytophthora ramorum surveys at Galician public parks (northwestern Spain) in 2010, established Rhododendron spp. plants were observed to be exhibiting leaf spots and necrosis, shoot blight, and cankers and dieback of shoots and branches. Branches and leaves of affected rhododendrons contained pseudothecia with bitunicate asci and hyaline pseudoparaphyses, and pycnidia were observed within the same stromatic masses. Symptomatic samples were disinfested in 0.5% sodium hypochlorite for 3 min. Tissues were cut from the margin of lesions, placed onto malt extract agar amended with streptomycin (25 μg ml–1), and incubated at 25°C in the dark. Cultures displaying morphological characteristics associated with Botryosphaeriaceae species were subcultured on 2% water agar with sterilized Pinus pinaster needles as a substrate and incubated at 25°C under near-UV light to encourage pycnidial production (1). Single conidial cultures gave rise to two distinct colonies on potato dextrose agar (PDA) at 25°C. In type 1, isolates produced a sparse, aerial mycelium and a characteristic yellow pigment that was more intense after 3 days, thereafter becoming violaceous and gradually turning dark gray. Growth occurred in the range of 4 to 38°C with an optimum at 29°C. Conidia were hyaline, fusiform, aseptate, thin walled, and averaged 21.1 (14.3 to 25.0) × 5.7 (4.3 to 6.8) μm with a length/width (L/W) ratio of 3.7 ± 0.4 (n = 100). On the basis of these characteristics, isolates were identified as Neofusicoccum luteum (1,3). Colonies of type 2 produced a dense, white-to-yellowish mycelium that rapidly became gray followed by marked diurnal zonation. Mycelial growth occurred in the range of 6 to 38°C with an optimum at 29 to 30°C. Conidia were hyaline, elliptical or fusiform, aseptate, thin walled, and averaging 18.3 (14.1 to 20.7) × 5.8 (4.6 to 7.0) μm with a L/W ratio of 3.2 ± 0.4 (n = 100). These isolates were identified as N. parvum (1,2). Identity was confirmed by DNA sequences analysis of internal transcribed spacer (ITS) regions. Comparison of the sequences of type 1 and 2 showed 100% homology with N. luteum and N. parvum (GenBank Accession Nos. EU673311 and GU251146, respectively). Representative sequences were deposited at GenBank (Accession Nos. HQ197352 and HQ197351). Pathogenicity of each isolate of N. luteum and N. parvum was confirmed by inoculating four 3-year-old Rhododendron spp. seedlings grown in pots. Shallow cuts were made in three branches of each plant. A colonized 6-mm agar plug, removed from the margin of an actively growing colony, was inserted beneath the flap and sealed with Parafilm. Four control seedlings received only sterile PDA agar plugs. Plants were maintained at 26°C and 70% humidity for 21 days. Inoculated plants began showing symptoms after 3 days. Necrosis progressed quickly and bidirectionally from the wound, resulting in death of leaves and wilting of shoots. N. luteum and N. parvum were reisolated from all inoculated plants but not from the controls. To our knowledge, this is the first report of N. luteum and N. parvum on Rhododendron spp. in Spain. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) S. R. Pennycook et al. Mycotaxon 24:445, 1985. (3) A .J. L. Phillips et al. Sydowia 54:59, 2002.

scholarly journals First Report of Leaf Spot Caused by Alternaria alternata on Kiwifruit in Italy

Plant Disease ◽  
1999 ◽  
Vol 83 (5) ◽  
pp. 487-487 ◽  
Author(s):  
L. Corazza ◽  
L. Luongo ◽  
M. Parisi
Keyword(s):  
New Zealand ◽  
Alternaria Alternata ◽  
Leaf Spot ◽  
Southern Italy ◽  
Morphological Characteristics ◽  
Potato Dextrose Agar ◽  
First Report ◽  
Leaf Spots ◽  
Detached Leaves ◽  
Pathogenicity Tests

A leaf spot of kiwifruit (Actinidia deliciosa (A. Chev.) C. F. Liang & A. R. Ferg.) leaves was recently observed on plants of the cultivar Hayward in an orchard near Salerno, in southern Italy. The affected plants showed early severe defoliation. The fungus isolated from the infected leaves was identified as Alternaria alternata (Fr.:Fr.) Keissl., based on conidial morphological characteristics. Pathogenicity tests were made by inoculating detached leaves of male pollinator cultivar Tomuri and the female cultivars Hayward and Bruno with a 7-mm disk taken from actively growing cultures of the fungus on potato dextrose agar (PDA). After 14 days, necrotic leaf spots developed and A. alternata was consistently isolated from the inoculated leaves. A. alternata has been observed as a pathogen on leaves and fruits in New Zealand. In the Mediterranean, it has been reported in Israel (2) and in the island of Crete (1). This is the first report of Alternaria leaf spot on kiwifruit in Italy. References: (1) V. A. Bourbos and M. T. Skoudridakis. Petria 7:111, 1997. (2) A. Sive and D. Resnizky. Alon Hanotea 41:409, 1987.

scholarly journals Native and introduced bee abundances on carrot seed crops in New Zealand

2015 ◽  
Vol 68 ◽  
pp. 373-379 ◽  
Author(s):  
B.G. Howlett ◽  
G.O. Lankin-Vega ◽  
D.E. Pattemore
Keyword(s):  
New Zealand ◽  
Honey Bees ◽  
Bombus Terrestris ◽  
Pollen Flow ◽  
Male Sterile ◽  
Important Crop ◽  
Carrot Seed ◽  
Seed Crops ◽  
Abundance And Distribution

In New Zealand unmanaged bees species can be important crop pollinators but their abundance and distribution is poorly known within hybrid carrot seed crops Standardised counts of bees visiting flowering carrot umbels (1350 umbels observed/field) across 19 commercial hybrid fields were conducted between 1000 h and 1500 h Despite honey bees being observed in all fields abundance varied greatly between fields (mean981; maximum330 minimum1) Other bees observed visiting umbels were Lasioglossum sordidum (17 fields; mean14; maximum65); Leioproctus sp (12 fields; mean20; maximum19); Hylaeus sp (one field; maximum 1) and Bombus terrestris (six fields; mean20; maximum11) The number of individual bees (all species together) counted/ umbel on male fertile umbels was significantly higher than on male sterile umbels a factor that could contribute to suboptimal pollen flow between umbel lines by bees Examination of their movements between male fertile and sterile lines is required to verify their efficiency as pollinators

scholarly journals First Report of Phytophthora syringae on Cedrus libani in Turkey

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 846-846 ◽  
Author(s):  
T. Doğmuş-Lehtijärvi ◽  
A. G. Aday Kaya ◽  
A. Lehtijärvi ◽  
T. Jung
Keyword(s):  
Average Length ◽  
Morphological Characteristics ◽  
Soil Samples ◽  
Morphological Identification ◽  
First Report ◽  
Cedrus Libani ◽  
Initial Symptoms ◽  
Lebanon Cedar ◽  
Forest Nurseries ◽  
Β Tubulin

Cedrus libani, commonly known as Lebanon cedar, is one of the most important coniferous tree species in Turkey. Its main distribution is in the Taurus Mountains in the Mediterranean Region. The total area of pure Taurus cedar forest covers 109,440 ha in Turkey, all located in the southwestern regions of the country. Due to its drought resistance, Taurus cedar has been commonly used for afforestations in these semi-arid areas (1). In September 2011, during surveys for Phytophthora spp. in forest nurseries in Adapazari and İzmir in eastern Turkey, initial symptoms such as death of fine roots, yellowing, and wilting of Taurus cedar seedlings were observed. Soil samples were collected from 10 symptomatic C. libani seedlings and isolation tests for Phytophthora species were carried out using leaflets from young Quercus suber, Azalea sp., and Rhodendron sp. saplings as baits floated over flooded soil. Necrotic baits were blotted dry, cut into small pieces, and placed on selective PARPNH carrot agar. Out growing colonies were subcultured on carrot agar and kept at 12°C for morphological and molecular identifications (2). In total, six Pythiaceous isolates were obtained from the C. libani soil samples. The isolates were investigated using a light microscope and grouped according to their morphological characteristics (3). DNA was extracted from two representative isolates using Qiagen DNeasy Plant Mini Kit following the manufacturer's instructions. PCR amplifications and sequencing of the internal transcribed spacer (ITS) region of rDNA and the β-tubulin gene were performed using ITS1 and ITS4 and Tub1 and Tub2 primer sets (4). Sequencing of the PCR products in both directions was conducted by IonTek Inc. (Istanbul, Turkey) in an ABI PRISM automated sequencer. The obtained sequences were compared with those in the GenBank and Phytophthora database using BLAST search. On the basis of morphological features and molecular analyses, the two isolates were identified as Phytophthora syringae. Morphological characteristics on carrot agar were identical with the description of P. syringae (2). At 20°C, colonies reached 7 cm in diameter after 1 week. Sporangia were semipapillate to non-papillate, ovoid, with average length of 59 μm (SD ± 2.8) (range 58 to 70 μm). Oogonia were 38 μm (SD ± 5.4) in diameter (range 30 to 47 μm) with paragynous antheridia. The morphological identification was confirmed by sequence comparison at GenBank with 99% homology for both ITS and β-tubulin. The ITS sequences of the two isolates were deposited in GenBank with the accession nos. KF430614 and KF944377. Under-bark inoculation tests with mycelia plugs were conducted with both isolates of P. syringae at 18°C in a growth chamber on a total of six 1-year-old shoots cut from two C. libani trees. Lesions with an average length of 19 mm (SD ± 6) developed after 10 days. P. syringae was consistently re-isolated from the margins of necrotic tissues. Control shoots remained symptomless. To our knowledge, this is the first report of damage caused by P. syringae on C. libani seedlings in forest nursery in Turkey. References: (1) T. Çalışkan. Pages 109-130 in: Proceedings of Workshop “Hızlı gelişen türlerle ilgili rapor,” Ankara, Turkey, 1998. (2) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (3) T. Jung et al. Mycol. Res. 107:772, 2003. (4) L. P. N. M. Kroon et al. Fung. Genet. Biol. 41:766, 2004.

scholarly journals First Report of Verticillium Wilt caused by Verticillium dahliae Kleb. on New Zealand Spinach (Tetragonia tetragonioides) in Italy

Plant Disease ◽  
2013 ◽  
Vol 97 (1) ◽  
pp. 145-145
Author(s):  
A. Garibaldi ◽  
S. Rapetti ◽  
P. Martini ◽  
L. Repetto ◽  
D. Bertetti ◽  
...  
Keyword(s):  
New Zealand ◽  
Verticillium Wilt ◽  
Verticillium Dahliae ◽  
Vascular Tissue ◽  
Spinacia Oleracea ◽  
Morphological Characteristics ◽  
Conidial Suspension ◽  
Potato Dextrose Broth ◽  
First Report ◽  
Tetragonia Tetragonioides

Tetragonia tetragonioides (New Zealand spinach, Aizoaceae) is an Australasian annual species that occurs naturally in Italy, where it is cultivated for the edible young shoots and succulent leaves. In September 2011, a previously unknown wilt was observed in 10 private gardens, each 0.1 to 0.5 ha, near Castellaro, Northern Italy, on 7-month-old New Zealand spinach plants. Leaves wilted, starting from the collar and moving up the plant, and vascular tissues showed brown streaks in the roots, crowns, and stems. Diseased plants were stunted with small, chlorotic leaves. Infected stems and leaves then wilted, and plants often died. Of about 500 plants, 30% were affected. Stems of 10 diseased plants were disinfected with 1% NaOCl for 1 min. Sections of symptomatic vascular tissue were plated on potato dextrose agar. After 3 days at 23 ± 1°C, colonies developed that were white and turned a grey to dark green color. Irregular, black microsclerotia (32.0) 63.1 ± 16.8 μm (106.1) × (18.7) 39.1 ± 12.3 μm (65.8) developed in hyaline hyphae after 8 days. Hyaline, elliptical, single-celled conidia (2.7) 3.8 ± 0.6 μm (4.8) × (1.9) 2.6 ± 0.5 μm (3.5) developed on verticillate conidiophores with three phialides at each node. Based on these morphological characteristics, the fungus was identified as Verticillium dahliae (1). The internal transcribed spacer (ITS) region of rDNA was amplified for one isolate using the primers ITS1/ITS4 (3) and sequenced (GenBank Accession No. JX308315). BLASTn analysis of the 479-bp segment showed 100% homology with the ITS sequence of a V. dahliae isolate (AB551206). Pathogenicity tests were performed twice using 60-day-old plants of T. tetragonioides. Unwounded roots of eight plants were dipped for 1 min in a conidial suspension (5 × 107 conidia/ml) of one isolate of V. dahliae obtained from the original infected New Zealand spinach plants, and grown in potato dextrose broth. The inoculated plants were transplanted into 2-liter pots (1 plant/pot) containing steamed potting mix (sphagnum peat-perlite-pine bark-clay; 50:20:20:10) and maintained in a growth chamber at 20 to 24°C and 50 to 80% RH. Eight plants immersed in sterile water served as a control treatment. Wilt symptoms were observed 30 days after inoculation, with vascular discoloration in the roots, crowns and stems. V. dahliae was reisolated consistently from infected tissues, but not from the control plants that remained healthy. Pathogenicity was also tested using the same method on plants of four cultivars (five plants/cultivar) of Spinacia oleracea (Matador, Asti, Merlo Nero, and America). Wilt symptoms developed on all cultivars and V. dahliae was reisolated from each inoculated plant. No fungal colonies were reisolated from control plants, which remained healthy. To our knowledge, this is the first report of Verticillium wilt caused by V. dahliae on T. tetragonioides in Italy, as well in Europe. V. dahliae was reported on T. tetragonioides in Canada (2). At this time, the economic impact of Verticillium wilt on New Zealand Spinach in Italy is limited, although the use of this vegetable in Italy is increasing. References: (1) G. F. Pegg and B. L. Brady. Verticillium Wilts. CABI Publishing, Wallingford, UK, 2002. (2) M. J. Richardson. Page 387 in: An Annotated List of Seed-Borne Diseases, Fourth Edition. International Seed Testing Association, Zurich, Switzerland, 1990. (3) T. J. White et al. Page 315 in: PCR Protocols. A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

scholarly journals Diaporthe species causing stem gray blight of red-fleshed dragon fruit (Hylocereus polyrhizus) in Malaysia

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Abd Rahim Huda-Shakirah ◽  
Yee Jia Kee ◽  
Kak Leong Wong ◽  
Latiffah Zakaria ◽  
Masratul Hawa Mohd
Keyword(s):  
Dna Sequences ◽  
Morphological Characteristics ◽  
First Report ◽  
Fungal Isolates ◽  
Dragon Fruit ◽  
Cameron Highlands ◽  
Hylocereus Undatus ◽  
Hylocereus Polyrhizus ◽  
Β Tubulin

AbstractThis study aimed to characterize the new fungal disease on the stem of red-fleshed dragon fruit (Hylocereus polyrhizus) in Malaysia, which is known as gray blight through morphological, molecular and pathogenicity analyses. Nine fungal isolates were isolated from nine blighted stems of H. polyrhizus. Based on morphological characteristics, DNA sequences and phylogeny (ITS, TEF1-α, and β-tubulin), the fungal isolates were identified as Diaporthe arecae, D. eugeniae, D. hongkongensis, D. phaseolorum, and D. tectonendophytica. Six isolates recovered from the Cameron Highlands, Pahang belonged to D. eugeniae (DF1 and DF3), D. hongkongensis (DF9), D. phaseolorum (DF2 and DF12), and D. tectonendophytica (DF7), whereas three isolates from Bukit Kor, Terengganu were recognized as D. arecae (DFP3), D. eugeniae (DFP4), and D. tectonendophytica (DFP2). Diaporthe eugeniae and D. tectonendophytica were found in both Pahang and Terengganu, D. phaseolorum and D. hongkongensis in Pahang, whereas D. arecae only in Terengganu. The role of the Diaporthe isolates in causing stem gray blight of H. polyrhizus was confirmed. To date, only D. phaseolorum has been previously reported on Hylocereus undatus. This is the first report on D. arecae, D. eugeniae, D. hongkongensis, D. phaseolorum, and D. tectonendophytica causing stem gray blight of H. polyrhizus worldwide.

Sign in / Sign up

Export Citation Format

Share Document