scholarly journals Design of a Polymerase Chain Reaction for Specific Detection of Corn Stunt Spiroplasma

Plant Disease ◽  
2001 ◽  
Vol 85 (5) ◽  
pp. 475-480 ◽  
Author(s):  
Thereza S. L. Barros ◽  
Robert E. Davis ◽  
Renato O. Resende ◽  
Ellen L. Dally
Keyword(s):  
Polymerase Chain Reaction ◽  
Dna Amplification ◽  
Pcr Primers ◽  
Limiting Factor ◽  
Chain Reaction ◽  
Specific Pcr ◽  
Spiroplasma Kunkelii ◽  
Detection And Identification ◽  
Corn Stunt ◽  
Polymerase Chain

Corn stunt disease is a major limiting factor in production of corn (Zea mays) in the Americas. To develop a polymerase chain reaction (PCR) assay specific for detection of the causal agent, Spiroplasma kunkelii, PCR primers were designed on the basis of unique regions of the nucleotide sequence of the S. kunkelii spiralin gene. DNA was amplified in PCRs containing template DNAs derived from laboratory strains of S. kunkelii and from naturally diseased corn plants collected in the field. No DNA amplification was observed in PCRs containing template DNAs derived from other Spiroplasma species tested or from healthy corn or corn infected by maize bushy stunt phytoplasma. The availability of a sensitive and specific PCR for detection and identification of S. kunkelii should facilitate studies of the ecology of this pathogen, as well as its influence in the incidence, spread, and severity of corn stunting diseases.

scholarly journals Élelmiszer-biztonsági jelentőségű baktériumok molekuláris detektálásának fejlesztése miniatürizált mikrofluidikai eszközök segítségével

2015 ◽  
Vol 156 (51) ◽  
pp. 2082-2088
Author(s):  
Kristóf Iván ◽  
Anna Maráz
Keyword(s):  
Polymerase Chain Reaction ◽  
Pathogenic Bacteria ◽  
Lab On A Chip ◽  
Dna Amplification ◽  
Molecular Techniques ◽  
Microbiological Analysis ◽  
Chain Reaction ◽  
Detection And Identification ◽  
Food Borne ◽  
Polymerase Chain

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification – most frequently real-time polymerase chain reaction – methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple – often automated – use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors’ research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria. Orv. Hetil., 2015, 156(51), 2082–2088.

scholarly journals A Polymerase Chain Reaction Protocol for the Detection of Clavibacter xyli subsp. xyli, the Causal Bacterium of Sugarcane Ratoon Stunting Disease

Plant Disease ◽  
1998 ◽  
Vol 82 (3) ◽  
pp. 285-290 ◽  
Author(s):  
Y.-B. Pan ◽  
M. P. Grisham ◽  
D. M. Burner ◽  
K. E. Damann ◽  
Q. Wei
Keyword(s):  
Polymerase Chain Reaction ◽  
Genomic Dna ◽  
Its Region ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Ratoon Stunting Disease ◽  
Specific Pcr ◽  
Polymerase Chain ◽  
Sugarcane Ratoon

A polymerase chain reaction (PCR) protocol was developed that specifically detected Clavibacter xyli subsp. xyli, the causal agent of sugarcane ratoon stunting disease. Generic PCR products from the intergenic transcribed spacer (ITS) region of 16S-23S ribosomal DNA of C. xyli subsp. xyli and C. xyli subsp. cynodontis were cloned and sequenced. Based on a multiple sequence alignment among these two sequences and other nonredundant highly homologous sequences from the database, two C. xyli subsp. xyli-specific PCR primers were designed, Cxx1 (5′ CCGAAGTGAGCAGATTGACC) and Cxx2 (5′ ACCCTGTGTTGTTTTCAACG). These two 20-mer oligonucleotides primed the specific amplification of a 438-bp DNA product from genomic DNA samples of 21 C. xyli subsp. xyli strains. Amplification was not observed with genomic DNA of one C. xyli subsp. cynodontis strain, five strains of four other Clavibacter species, and two strains of two Rathayibacter species. The 438-bp PCR product also was amplified directly from cultured C. xyli subsp. xyli cells and from C. xyli subsp. xyli-infected sugarcane vascular sap with a unique reaction buffer containing polyvinylpyrrolidone and ficoll. Extraction of genomic DNA was not necessary prior to PCR assay.

scholarly journals Experimental Infections and Natural Outbreaks of Eperythrozoonosis in Pigs Identified by PCR-DNA Hybridizations

1993 ◽  
Vol 5 (3) ◽  
pp. 351-358 ◽  
Author(s):  
Richard D. Oberst ◽  
Sharon M. Gwaltney ◽  
Michael P. Hays ◽  
Sandra Morgan ◽  
Earnest L. Stair
Keyword(s):  
Polymerase Chain Reaction ◽  
Experimental Infection ◽  
Dna Amplification ◽  
Hybridization Assay ◽  
Chain Reaction ◽  
Blood Samples ◽  
Specific Pcr ◽  
Laboratory Procedures ◽  
Polymerase Chain ◽  
Dna Hybridizations

Eperythrozoon-specific DNA amplification reactions and subsequent hybridizations with an eperythrozoon DNA probe (KSU-2) were used in experimental infection studies to identify Eperythrozoon suis DNA in the blood of splenectomized and nonsplenectomized pigs. The results indicate that E. suis DNA is present in nonsplenectomized pigs at levels that can be amplified by polymerase chain reaction (PCR) and identified in DNA hybridizations within 24 hours after infection. The ability of the E. suis PCR/hybridization assay to detect eperythrozoonosis was further demonstrated in blood samples collected from pigs in 2 separate natural outbreaks in Oklahoma. Results from these initial samplings indicate that pigs infected with E. suis from geographically distinct locations can be identified using the eperythrozoon-specific PCR/hybridization assay, which offers many advantages over conventional laboratory procedures for diagnosing eperythrozoonosis in pigs.

scholarly journals Development of Polymerase Chain Reaction Primers Highly Specific for Xanthomonas albilineans, the Causal Bacterium of Sugarcane Leaf Scald Disease

Plant Disease ◽  
1999 ◽  
Vol 83 (3) ◽  
pp. 218-222 ◽  
Author(s):  
Y.-B. Pan ◽  
M. P. Grisham ◽  
D. M. Burner ◽  
B. L. Legendre ◽  
Q. Wei
Keyword(s):  
Polymerase Chain Reaction ◽  
Bacterial Species ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Multiple Sequence ◽  
Leaf Scald ◽  
Specific Pcr ◽  
Polymerase Chain ◽  
Xanthomonas Albilineans

New primers were developed that greatly improved the specificity of the polymerase chain reaction (PCR) protocol for Xanthomonas albilineans, the causal agent of sugarcane leaf scald disease. Length-polymorphic PCR products, amplified under the current PCR protocol from the 16S-23S ribosomal DNA intergenic transcribed spacers (ITS) of X. albilineans and three unidentified sugarcane saprophytic bacterial species, were cloned and sequenced. Fourteen other nonredundant ITS sequences retrieved from the database were highly homologous to the sequence of X. albilineans. Two X. albilineans-specific PCR primers, namely, PGBL1 (5′ CTT TGG GTC TGT AGC TCA GG) and PGBL2 (5′ GCC TCA AGG TCA TAT TCA GC), were designed based on a multiple sequence alignment among these 18 sequences. These two primers permitted specific PCR amplification of a 288-bp DNA product from all 71 diverse X. albilineans strains tested. No amplification product was observed from any other bacterial species tested, including the three unidentified sugarcane saprophytes. The new PCR protocol has been routinely used to detect the leaf scald pathogen from infected sugarcane tissues.

PCR BY THERMAL CONVECTION

2004 ◽  
Vol 18 (16) ◽  
pp. 775-784 ◽  
Author(s):  
DIETER BRAUN
Keyword(s):  
Polymerase Chain Reaction ◽  
Thermal Convection ◽  
Dna Amplification ◽  
Reaction Vessel ◽  
Cold Region ◽  
Chain Reaction ◽  
Heating And Cooling ◽  
Highly Sensitive ◽  
Specific Amplification ◽  
Polymerase Chain

The Polymerase Chain Reaction (PCR) allows for highly sensitive and specific amplification of DNA. It is the backbone of many genetic experiments and tests. Recently, three labs independently uncovered a novel and simple way to perform a PCR reaction. Instead of repetitive heating and cooling, a temperature gradient across the reaction vessel drives thermal convection. By convection, the reaction liquid circulates between hot and cold regions of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates into twice the amount in the cold region. The amplification progresses exponentially as the convection moves on. We review the characteristics of the different approaches and show the benefits and prospects of the method.

Detection and identification of Candida spp. in human serum by LightCycler® real-time polymerase chain reaction

2008 ◽  
Vol 60 (3) ◽  
pp. 263-271 ◽  
Author(s):  
Catherine Dunyach ◽  
Sébastien Bertout ◽  
Cécile Phelipeau ◽  
Pascal Drakulovski ◽  
Jacques Reynes ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Human Serum ◽  
Real Time ◽  
Chain Reaction ◽  
Candida Spp ◽  
Detection And Identification ◽  
Polymerase Chain

Detection ofErwinia amylovorain plant material using novel polymerase chain reaction (PCR) primers

2001 ◽  
Vol 29 (1) ◽  
pp. 35-43 ◽  
Author(s):  
R. K. Taylor ◽  
P. J. Guilford ◽  
R. G. Clark ◽  
C. N. Hale ◽  
R. L. S. Forster
Keyword(s):  
Polymerase Chain Reaction ◽  
Plant Material ◽  
Pcr Primers ◽  
Chain Reaction ◽  
Polymerase Chain

Genetic diversity and phylogeny analysis of Azolla based on DNA amplification by arbitrary primers

Genome ◽  
1993 ◽  
Vol 36 (4) ◽  
pp. 686-693 ◽  
Author(s):  
Benoit Van Coppenolle ◽  
Iwao Watanabe ◽  
Charles Van Hove ◽  
Gerard Second ◽  
Ning Huang ◽  
...  
Keyword(s):  
Principal Component Analysis ◽  
Polymerase Chain Reaction ◽  
Principal Component ◽  
Dna Amplification ◽  
Component Analysis ◽  
Genetic Distances ◽  
Group Method ◽  
Chain Reaction ◽  
Arbitrary Primers ◽  
Polymerase Chain

The polymerase chain reaction was used to amplify random sequences of DNA from 25 accessions of Azolla to evaluate the usefulness of this technique for identification and phylogenetic analysis of this aquatic fern. Accessions were selected to represent all known species within the genus Azolla and to encompass the worldwide distribution of the fern. Primers of 10 nucleotides with 70% G + C content were used to generate randomly amplified polymorphic DNA from the symbiotic Azolla–Anabaena complex. Twenty-two primers were used and each primer gave 4–10 bands of different molecular weights for each accession. Bands were scored as present or absent for each accession and variation among accessions was quantified using Nei's genetic distances. A dendrogram summarizing phenetic relationships among the 25 accessions was generated using the unweighted pair-group method with arithmetic mean. Principal component analysis was also used to evaluate genetic similarities. Three distinct groups were identified: group 1 contains five species, group 2 contains the pinnata species, and group 3 contains the nilotica species. The analysis demonstrates that the major groups of Azolla species can be easily distinguished from one an other and, in addition, that closely related accessions within species can be identified. We further found that using 10 primers, a phylogeny that is essentially the same as that derived from 22 primers can be constructed. Our results suggest that total DNA extracted from the Azolla–Anabaena symbionts is useful for classification and phylogenetic studies of Azolla.Key words: Azolla–Anabaena symbiosis, genetic distances, polymerase chain reaction, principal component analysis.

scholarly journals Use of the polymerase chain reaction for detection of Fusarium graminearum in bulgur wheat

2012 ◽  
Vol 32 (1) ◽  
pp. 201-208 ◽  
Author(s):  
Carla Bertechini Faria ◽  
Giovana Caputo Almeida-Ferreira ◽  
Karina Bertechine Gagliardi ◽  
Tatiane Cristina Albuquerque Alves ◽  
Dauri José Tessmann ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Fusarium Graminearum ◽  
Genomic Dna ◽  
Solid Medium ◽  
Food Contamination ◽  
Chain Reaction ◽  
Specific Pcr ◽  
Culture Characteristics ◽  
Mycotoxigenic Fungi ◽  
Polymerase Chain

The detection of mycotoxigenic fungi in foodstuff is important because their presence may indicate the possible associated mycotoxin contamination. Fusarium graminearum is a wheat pathogen and a producer of micotoxins. The polymerase chain reaction (PCR) has been employed for the specific identification of F. graminearum. However, this methodology has not been commonly used for detection of F. graminearum in food. Thus, the objective of the present study was to develop a molecular methodology to detect F. graminearum in commercial samples of bulgur wheat. Two methods were tested. In the first method, a sample of this cereal was contaminated with F. graminearum mycelia. The genomic DNA was extracted from this mixture and used in a F. graminearum specific PCR reaction. The F. graminearum species was detected only in samples that were heavily contaminated. In the second method, samples of bulgur wheat were inoculated on a solid medium, and isolates having F. graminearum culture characteristics were obtained. The DNA extracted from these isolates was tested in F. graminearum specific PCR reactions. An isolate obtained had its trichothecene genotype identified by PCR. The established methodology could be used in surveys of food contamination with F. graminearum.

scholarly journals HTLV-I-induced lymphoma mimicking Hodgkin's disease. Diagnosis by polymerase chain reaction amplification of specific HTLV-I sequences in tumor DNA

Blood ◽  
1988 ◽  
Vol 71 (4) ◽  
pp. 1027-1032 ◽  
Author(s):  
DB Duggan ◽  
GD Ehrlich ◽  
FP Davey ◽  
S Kwok ◽  
J Sninsky ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Hodgkin's Disease ◽  
Polymerase Chain Reaction Amplification ◽  
Hodgkin’S Disease ◽  
Dna Amplification ◽  
Disease Diagnosis ◽  
Lymphoproliferative Disease ◽  
Enzyme Linked Immunosorbent Assay ◽  
Chain Reaction ◽  
Polymerase Chain

Abstract A patient with a localized HTLV-I-associated lymphoproliferative disease that was misdiagnosed as Hodgkin's disease is presented. The patient's serum was negative for HTLV-I antibodies by enzyme-linked immunosorbent assay (ELISA), Western blot, and radioimmunoprecipitation. Tumor tissue DNA was negative for HTLV-I by Southern blotting but was positive for distinct HTLV-I sequences when subjected to DNA amplification using the polymerase chain reaction. We conclude that the clinical and pathologic diagnosis of HTLV-I-related lymphoma can be difficult and can be confused with Hodgkin's disease. Extremely sensitive molecular biological techniques may be required to establish a diagnosis of HTLV-I-induced lymphoma.

Sign in / Sign up

Export Citation Format

Share Document