TRAF6-Dominant Negative Peptides Show Potent Inhibitory Effects On Multiple Myeloma, Osteoclast Formation and Bone Resorption.

Blood ◽  
2009 ◽  
Vol 114 (22) ◽  
pp. 611-611
Author(s):  
Mingjie Li ◽  
Eric Sanchez ◽  
Jennifer Li ◽  
Cathy S Wang ◽  
Jing Shen ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Cell Proliferation ◽  
Amino Acid ◽  
Bone Resorption ◽  
Tumor Cell ◽  
Cell Apoptosis ◽  
Cell Formation ◽  
Osteoclast Formation ◽  
Dominant Negative ◽  
Control Peptide

Abstract Abstract 611 Tumor necrosis factor receptor-associated factor 6 (TRAF6) has been implicated in regulating NF-κB and JNK signal transduction pathway resulting in inhibition of tumor cell proliferation and osteoclast formation. The unique biological function of TRAF6 is largely determined within its TRAF-C domain which does not interact with peptide motifs that are recognized by other TRAFs including 1, 2, 3 or 5. We have recently reported inhibition of cell proliferation and increased apoptosis of multiple myeloma (MM) cells through regulation of the NF-κB and JNK pathways through silencing the TRAF6 C-domain mRNA. In this study, we determined the effects of TRAF6 dominant negative peptides on MM cells, osteoclast formation and bone resorption. We cloned a 167 amino acid (in residues 333 to 508) fragment to produce a TRAF6 negative dominant (TRAF6dn) construct and synthesized an inhibitory decoy peptide of the TRAF6 interaction domain with CD40 and another peptide interacting with the TRAF6-RANK binding domain as well as a control peptide. All peptides were synthesized with a 16 amino acid permeable peptide. Using the MM1s, RPMI8226, and U266, we evaluated the effects of these peptides on MM tumor cell growth using an MTS assay and apoptosis with an Annexin V assay. We found that TRAF6dn peptides significantly inhibited MM cell proliferation maximally at 72 hours whereas effects on induction of apoptosis in MM cells were most prominent at 48 hours. The decrease in cell proliferation and increase in cell apoptosis occurred in a concentration-dependent fashion. We found that TRAF6dn also markedly inhibited osteoclast cell formation from freshly derived human monocytes induced by RANKL and M-CSF in a concentration-dependent fashion comparing with cells exposed to control peptide. We further examined the effects on MM cell apoptosis of the TRAF6 decoy or CD40 decoy peptides alone and in cells exposed to the combination of both peptides. The results showed either decoy peptide alone slightly induced apoptosis of MM tumor cells whereas the combination of both peptides demonstrated marked apoptosis of MM cells. We also showed that although melphalan alone induced apoptotic cell death, this effect was markedly enhanced when this alkylating agent was combined with the TRAF6 decoy peptide. Although the CD40 peptide alone did not inhibit osteoclast formation, TRAF6 decoy peptide alone and the combination of both decoy peptides markedly inhibited formation of these bone resorbing cells. We also examined the effects of TRAF6dn on NF-κB and JNK by measuring JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. Phospho-NF-κB protein levels and phosphorylation of JNKK are both markedly reduced when MM cells are exposed to TRAF6dn fragment or TRAF6 decoy peptide. These studies suggest that TRAF6dn or the combination of TRAF6 decoy and CD40 decoy peptides may be excellent targets to block both myeloma cell and osteoclast cell formation. The study has been extended to assess the effects of these peptides in vivo using our SCID-hu murine model of human myeloma. Disclosures: No relevant conflicts of interest to declare.

Blockage of TRAF6 by Dominant Negative Peptides to Inhibit Multiple Myeloma (MM) Cell Proliferation and Osteoclast Formation through NF-κB, JNK and AKT Signal Transduction Pathways

Blood ◽  
2010 ◽  
Vol 116 (21) ◽  
pp. 4068-4068 ◽  
Author(s):  
Mingjie Li ◽  
Eric Sanchez ◽  
Cathy Wang ◽  
Megan Schultz ◽  
Jessica Wang ◽  
...  
Keyword(s):  
Signal Transduction ◽  
Multiple Myeloma ◽  
Cell Proliferation ◽  
Bone Resorption ◽  
Tumor Cells ◽  
Cell Apoptosis ◽  
Osteoclast Formation ◽  
Dominant Negative ◽  
Control Group ◽  
Affinity Column

Abstract Abstract 4068 Several members of the tumor necrosis factor receptor-associated factor (TRAF) family, including TRAF1, TRAF2, TRAF3, TRAF5, and TRAF6 have been implicated in regulating signal transduction from various TRAF family members. However, the unique biological function of TRAF6 is largely determined by its TRAF-C domain, which does not interact with peptide motifs that are recognized by TRAF1, -2, -3 or -5. We have reported inhibition of MM cell proliferation and increase of apoptosis through regulation of the NF-κB and JNK pathways through silencing TRAF6 C-domain mRNA and the dominant negative peptide expression vector (Chen H. et al, Oncogene, 2006; Li M. et al, Blood 2009). TRAF6 have been recently found as a ligase for Akt ubiquitination (Yang WL et al, Science, 2009). Akt signaling plays a central role in many biological functions, such as cell proliferation and apoptosis. In this study, we first investigated whether TRAF6 is over-expressed in MM tumor cells. Twelve MM fresh bone marrow (BM) aspirates derived from MM patients were assessed using Western blot analysis and immunohistochemical staining with anti-TRAF6 antibody. We found that TRAF6 protein was highly expressed in tumor cells from MM patients compared to normal human BM samples. Based on TRAF6, CD40, and RANKL sequences and crystal structures, we targeted the TRAF6 C-domain binding residues. We found that TRAF6 dominant negative binding peptide (TRAF6dn) significantly inhibited MM cell proliferation maximally at 72 hours using the MTS cell proliferation assay whereas effects on inducing MM cell apoptosis were most prominent at 48 hours as assessed with Annexin V staining with flow cytometric analysis. The decrease in cell proliferation and increase in cell apoptosis occurred in a concentration peptide-dependent fashion. Furthermore, phosphorylation of both AKT and NF-κB were also reduced using our human TRAF6dn or decoy peptides. We also examined the effect of the TRAF6dn peptide on the JNK pathway since this signaling pathway is also associated with cell cycle effects in MM. We measured JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. The results showed that the phosphorylation of JNKK is markedly reduced after treatment with the TRAF6dn peptide. Furthermore, we examined c-Jun, a component of the transcription factor complex AP-1, which binds and activates transcription at TRE/AP-1 elements. We evaluated the effect of TRAF6dn peptide on osteoclast formation using cells from human monocytes isolated by anti-CD14 micro-bead affinity column from MM patients' BM or peripheral blood mononuclear cells. The monocytes were cultured on slide-culture dishes (2 × 105 cells/well).We found TRAF6dn markedly inhibited osteoclast cell formation from monocytes induced with RANKL and mCSF in a concentration- dependent fashion compared with a control group using tartrate resistant acid phosphatase staining. We further assessed whether TRAF6dn can reduce bone resorption using a dentin bone resorption assay. BM-derived monocytes were isolated as above and were cultured on dentin bone slides (4 × 105 cells/slide). The cells treated with a TRAF6dn peptide or the control peptide, were incubated with 50ng/ml RANKL and 10ng/ml MCSF. All cells were cultured for 21 days. It was found that TRAF6dn significantly inhibited lacunar resorption in a concentration-dependent fashion. These studies suggest that TRAF6 is over-expressed in MM and our TRAF6dn peptide inhibits many signaling pathways critical to the growth of MM and formation of osteoclasts resulting in marked anti-MM effects and reduction in osteoclast formation resulting in marked inhibition of bone resorption. Thus, this novel approach may offer a new therapeutic approach to both treat multiple myeloma and reduce the clinical consequences resulting from enhanced bone loss that commonly occur in these patients. Disclosures: No relevant conflicts of interest to declare.

TRAF6 Dominant Negative Peptides Block Intracellular Signaling Resulting in Anti-Myeloma and Anti-Bone Resorptive Effects in Multiple Myeloma

Blood ◽  
2011 ◽  
Vol 118 (21) ◽  
pp. 2919-2919
Author(s):  
Mingjie Li ◽  
Marissa P Dreyer ◽  
Cameryn P Ahles ◽  
David Ramirez ◽  
Cydney M Nichols ◽  
...  
Keyword(s):  
Gene Expression ◽  
Multiple Myeloma ◽  
Cell Proliferation ◽  
Tumor Cells ◽  
Intracellular Signaling ◽  
Conflicts Of Interest ◽  
Cell Formation ◽  
Osteoclast Formation ◽  
Dominant Negative ◽  
Rt Pcr

Abstract Abstract 2919 Tumor necrosis factor receptor-associated factor 6 (TRAF6) has been implicated in regulating the NF-kB and JNK signal transduction pathways; and, thus, is likely to promote tumor cell proliferation and osteoclast formation. We have previously reported inhibition of cell proliferation and increase of apoptosis in multiple myeloma (MM) cells through regulation of these intracellular pathways through silencing of TRAF6 C-domain mRNA. To determine TRAF6 protein expression in fresh MM tumor cells, we performed an immunofluorescence assay (IFA). The results showed that expression of this factor in tumor cells from bone marrow (BM) from MM patients with progressive disease is higher than in cells from patients with monoclonal gammopathies without disease progression or normal controls. We further examined the effects of TRAF6 negative dominant peptides on intracellular signaling pathways. Briefly, cells from the RPMI8226 or MM1s MM cell lines or primary MM BM samples were treated with or without TRAF6 inhibition peptide for 24 hours and then stimulated with either IGF1 (30ng/ml) or IL1 β (20ng/ml) for 30 minutes. The cells were lysed and Western blot analysis performed to determine protein phosphorylation and RT-PCR for gene expression. TRAF6 has been found to be an E3 ligase for Akt ubiquitination. We found that IGF1 increased the phosphorylation of AKT and treatment with TRAF6 inhibition peptide markedly decreased its phosphorylation compared to treatment with a control peptide in RPMI8226 and primary MM tumor cells. Downstream of AKT, C-Raf phosphorylation was also significantly reduced with treatment with TRAF6 inhibition peptide. Notably, cyclin D gene expression in MM tumor cells treated with TRAF6 inhibition peptide was reduced as determined with an RT-PCR. In contrast, the gene expression of mTOR was increased in RPMI8226 cells treated with TRAF6 inhibition peptide whereas there was no change in its expression in MM1s and primary MM tumor cells. It is quite possible that the increase in mTOR expression in RPMI8226 cells may act as a negative feedback which results from blockage of the ubiquitination of TRAF6. We further examined the effect of the TRAF6 inhibition peptide on NF-kB and JNK signaling as determined through evaluation of JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. Phospho-NF-kB protein was reduced and phosphorylation of JNKK was clearly decreased with exposure to the TRAF6 inhibition peptide. We examined c-Jun, a component of the transcription factor complex AP-1, which binds and activates transcription at TRE/AP-1 elements. Total endogenous c-Jun is reduced following exposure of RPMI8226 cells to the TRAF6 inhibition peptide. Consistent with our past findings, TRAF6 inhibition peptide significantly inhibited osteoclast formation from CD14+ induced by RANKL and M-CSF with in a concentration dependent fashion whereas control peptides showed no effects on osteoclast formation. In addition, inhibition of the TRAF6 signaling blocked not only myeloma cell proliferation induced by AKT and NF-kB activation but also osteoclast cell formation mediated through transcription at TRE/AP-1 elements. The study has been extended to our SCID-hu murine model of human myeloma. Disclosures: No relevant conflicts of interest to declare.

Blocking TRAF6 Function Domain by TRAF6 Dominant Negative (TRAF6dn) for Inhibition of Multiple Myeloma Cell Proliferative and Increase of Apoptosis through Regulation of NF-κB and JNK Pathways.

Blood ◽  
2006 ◽  
Vol 108 (11) ◽  
pp. 3434-3434
Author(s):  
Haiming Chen ◽  
Mingjie Li ◽  
Richard A. Campbell ◽  
Melinda S. Gordon ◽  
Dror Shalitin ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Cell Proliferation ◽  
Tumor Cell ◽  
Cell Apoptosis ◽  
Expression Vector ◽  
Myeloma Cell ◽  
Dominant Negative ◽  
Jnk Pathway ◽  
Multiple Myeloma Cell ◽  
Function Domain

Abstract Dominant negative inhibition is most commonly seen when a mutant subunit of a multi-subunit protein is co-expressed with the wild-type protein so that assembly of a functional oligomer is impaired. Studies have shown that TRAF6 plays a key role in the regulation of NF-κB through the IL-1R/TLR-TRAF6-TAK1-TAB1-TAB2-IkB-NF-κB pathway. We previously demonstrated that TRAF6 is an important factor for the activation of nuclear factor (NF)-κB signaling in multiple myeloma cell proliferation through the c-Jun N-terminal kinase (JNK) pathway and the pathway can be silenced by TRAF6 siRNA. (H. Chen et al. Oncogene, 2006). We targeted the TRAF6 function domain by designing primers targeting positive 1115 to 1818 (Forward: ggctagcatgtcagaggtccggaatttggag (Nhe1) Reverse: cgaagtactgatgcaggggtatagctcgagc (Xho1)) for hTRAF6dn according to GeneBank (NCBI) nucleotide sequence of human TRAF6 (#U78798). We cloned TRAF6 negative domain cDNA into PCRII-TOPO vector and subsequently re-cloned into the pLenti6.2 expression vector (pLenti6.2-hTRAF6dn). All constructs were confirmed by sequencing. Viral titers for all transfections were determined to be 107 plaque-forming units/ml. Expression levels as determined by flow cytometric analysis were >95% for all lentivirally encoded GFP gene products. The pLenti6.2-hTRAF6dn vector continually expressed the peptide for TRAF6dn during tumor cell proliferation. We found that TRAF6dn began to inhibit MM cell proliferation in the U266 myeloma cell line after 72 hours of culture and most prominently on day 6. However, the inhibition of RPMI8226 cell proliferation by TRAFdn started after 24 hours of culture whereas effects on inducing MM cell apoptosis were most prominent at 72 hours. The decrease in cell proliferation and increase in cell apoptosis occurred in a dose-dependent fashion. We also examined the effects of TRAF6dn on the NF-κB and JNK pathway since this signaling pathway is associated with cell cycle effects in myeloma. Phosphorylated NF-κB protein levels were reduced using the TRAF6dn expression vector. We also determined the phosphorylation of JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. The results showed that the phosphorylation of JNKK is clearly reduced following blocking the TRAF6 function domain with the TRAF6dn. Furthermore, we examined c-Jun, a component of the transcription factor complex AP-1, which binds and activates transcription at TRE/AP-1 elements. The transcriptional activity of c-Jun is regulated by SAPK/JNK binding to c-Jun and phosphorylation of c-Jun at Ser63/73. We found that total endogenous c-Jun is reduced after blocking the TRAF6 function domain with TRAF6dn in the RPMI8226 and U266 MM cell lines. Comparing TRAF6dn with TRAF6 siRNA, only the TRAF6dn inhibited the TRAF6 function domain. These studies suggest that the TRAF6dn peptide may impede myeloma cell signaling pathways resulting in inhibition of tumor cell growth and may represent a new approach to treating patients with MM.

Blockage of TRAF6 Signaling Inhibits Osteoclast Formation and Tumor Cell through Blocking the NF-kB and JNK Pathways in Multiple Myeloma.

Blood ◽  
2007 ◽  
Vol 110 (11) ◽  
pp. 2511-2511
Author(s):  
Haiming Chen ◽  
Mingjie Li ◽  
Jennifer Li ◽  
Richard A. Campbell ◽  
Cathy S. Wang ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Cell Growth ◽  
Tumor Cell ◽  
Tumor Cells ◽  
Osteoclast Formation ◽  
Dominant Negative ◽  
Control Group ◽  
Affinity Column ◽  
Tartrate Resistant Acid Phosphatase ◽  
Control Vector

Abstract We have recently shown that silencing of tumor necrosis factor receptor-associated factor 6 (TRAF6) with a C-terminal siRNA inhibits proliferation and increases apoptosis of multiple myeloma (MM) tumor cells. In addition, TRAF6 ubiquitin ligase is also essential for receptor activator of nuclear factor kappa B ligand (RANKL) signaling and osteoclast differentiation. Based on TRAF6, CD40, and RANKL sequences and the TRAF6 interaction domain with CD40 or RANKL resides between residues 333 to 508, we cloned a sequence representing a 167 amino acid sequence from this domain in order to produce a TRAF6 dominant negative fragment (TRAF6dn) from the NIH gene bank (U78798) into the PCRII-TOPO vector. Subsequently, we re-cloned this fragment into an expression vector (pLenti6.2-hTRAF6dn). Expression of the TRAF6 dominant negative peptide was confirmed by Western blot analysis. We used human MM monocytes isolated by anti-CD14 micro-bead affinity column from MM patients’ peripheral blood (PB) or bone marrow (BM). In order to quantify osteoclast formation, the cells were fixed and stained for tartrate resistant acid phosphatase following seven days of culture. The BM and PB CD14+ cells were cultured on slide-culture dishes at a density of 2 × 105 cells per well. The cells infected with the pLenti6.2-hTRAF6dn or with the control vector, pLenti6.2/GW/EmGFP, were treated with 50ng/ml RANKL and 10ng/ml mCSF at the beginning of the culture period, and these factors were added again during a medium change after three days of incubation. We found that the TRAF6dn vector significantly inhibited osteoclast cell formation of CD14+ cells induced by RANKL and mCSF in a concentration dependent fashion compared with the control group. Furthermore, we examined c-Jun, a component of the transcription factor complex AP-1, which binds and activates transcription at TRE/AP-1 elements. The results showed that total endogenous c-Jun is reduced after TRAF6dn blocks TRAF6 signaling whereas cells infected with the control vector showed no changes in c-Jun. We further examined the effects of TRAF6dn on MM cell growth and apoptosis. Both tumor cells from fresh MM BM and the U266 and MM1s cell lines showed decreased cell proliferation and increased apoptosis in the presence of the TRAF6dn vector at 72 hours whereas the control vector had no effect on MM tumor cell growth or apoptosis. Furthermore, the TRAF6dn vector led to marked decreases in phospho-NF-kB protein levels compared to the control vector. Thus, we have demonstrated that inhibition of TRAF6 with a dominant negative construct both inhibits MM cell growth as well as osteoclast formation, and also reduces NF-kB activation and c-Jun levels which likely results in decreased activation of TRE/AP-1 elements. These studies suggest that the inhibition of TRAF6 may be an excellent therapeutic target for multiple myeloma since its inhibition results in suppression of tumor growth as well as osteoclast formation.

SDX-308, a nonsteroidal anti-inflammatory agent, inhibits NF-κB activity, resulting in strong inhibition of osteoclast formation/activity and multiple myeloma cell growth

Blood ◽  
2006 ◽  
Vol 109 (5) ◽  
pp. 2130-2138 ◽  
Author(s):  
Rentian Feng ◽  
Gülsüm Anderson ◽  
Guozhi Xiao ◽  
Gary Elliott ◽  
Lorenzo Leoni ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Cell Proliferation ◽  
Bone Resorption ◽  
Bone Destruction ◽  
Structural Analog ◽  
Myeloma Cell ◽  
Osteoclast Formation ◽  
Myeloma Cells ◽  
Osteoclast Activity ◽  
Multiple Myeloma Cell

Abstract Multiple myeloma is characterized by increased osteoclast activity that results in bone destruction and lytic lesions. With the prolonged overall patient survival achieved by new treatment modalities, additional drugs are required to inhibit bone destruction. We focused on a novel and more potent structural analog of the nonsteroidal anti-inflammatory drug etodolac, known as SDX-308, and its effects on osteoclastogenesis and multiple myeloma cells. SDX-101 is another structural analog of etodolac that is already used in clinical trials for the treatment of B-cell chronic lymphocytic leukemia (B-CLL). Compared with SDX-101, a 10-fold lower concentration of SDX-308 induced potent (60%-80%) inhibition of osteoclast formation, and a 10- to 100-fold lower concentration inhibited multiple myeloma cell proliferation. Bone resorption was completely inhibited by SDX-308, as determined in dentin-based bone resorption assays. SDX-308 decreased constitutive and RANKL-stimulated NF-κB activation and osteoclast formation in an osteoclast cellular model, RAW 264.7. SDX-308 effectively suppressed TNF-α–induced IKK-γ and IκB-α phosphorylation and degradation and subsequent NF-κB activation in human multiple myeloma cells. These results indicate that SDX-308 effectively inhibits multiple myeloma cell proliferation and osteoclast activity, potentially by controlling NF-κB activation signaling. We propose that SDX-308 is a promising therapeutic candidate to inhibit multiple myeloma growth and osteoclast activity and that it should receive attention for further study.

SDX-308, a Structural Analog of Etodolac, Inhibits NF-κB Activity Resulting in Significant Inhibition of Osteoclast Formation/Activity and Multiple Myeloma Cell Growth.

Blood ◽  
2006 ◽  
Vol 108 (11) ◽  
pp. 3456-3456 ◽  
Author(s):  
Rentian Feng ◽  
Gulsum Anderson ◽  
Guozhi Xiao ◽  
Gary Elliott ◽  
Lorenzo M. Leoni ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Cell Proliferation ◽  
Cell Growth ◽  
Bone Resorption ◽  
Bone Destruction ◽  
Structural Analog ◽  
Myeloma Cell ◽  
Osteoclast Formation ◽  
Osteoclast Activity ◽  
Multiple Myeloma Cell

Abstract Multiple myeloma (MM) is characterized by increased osteoclast activity resulting in bone destruction and the development of lytic bone lesions. Current treatment modalities have resulted in an increased overall survival in MM patients and new drugs are required that specifically inhibit bone destruction. Etodolac is a non-steroidal anti-inflammatory drug that is approved for treatment of degenerative joint disease and rheumatoid arthritis. SDX-101, an R-enantiomer of Etodolac, was recently demonstrated to induce cytotoxicity, overcome drug resistance, and enhance the activity of dexamethasone in MM. SDX-308 is a novel and more potent etodolac structural analog with a more favorable safety profile than the racemic etodolac due to a lack of significant COX-inhibitory activity. In this study, we focused on effects of SDX-308 on osteoclastogenesis and MM cells. SDX-308 required a 10-fold lower concentration (5x10−6M) than SDX-101 (50x10−6M) to induce potent inhibition (60–80%) of osteoclast formation using mononuclear bone marrow cells from MM patients and healthy donors. Depending on the MM cell line (MM.1S, RPMI-822, or OPM2), SDX-308 required 10- to 100-fold lower concentration (1–10x10−6M) to inhibit MM cell proliferation compared to SDX-101 (10–100x10−6M). In addition, SDX-308 (7.5x10−6M) completely inhibited bone resorption as determined by dentin-based bone resorption assays. We found that pre-treatment of RAW264.7 osteoclast-like cells with SDX-308 decreased constitutive and RANKL-stimulated NF-κB activation measured by luciferase activity. Further, SDX-308 inhibited phosphorylation of p65, IκBα and p65 nuclear translocation in RAW264.7 cells. In addition, SDX-308 effectively suppressed TNFα-induced IKK-γ and IkB-α phosphorylation and degradation and subsequent NF-κB activation in human MM cells. Even in higher concentrations, SDX-101 was less effective in inhibiting NF-κB signaling. In conclusion, these results indicate that SDX-308 effectively inhibits multiple myeloma cell proliferation and osteoclast activity by specifically targeting the NF-κB signaling pathway. These results show that SDX-308 is a promising therapeutic candidate for inhibiting tumor cell growth and elevated osteoclast activity in MM.

Higher TRAF6 and Fbxo 3 Expression Is With Progressive Multiple Myeloma and Blockage Of TRAF6 Inhibits Tumor Growth and Bone Resorption

Blood ◽  
2013 ◽  
Vol 122 (21) ◽  
pp. 5362-5362
Author(s):  
Mingjie Li ◽  
Suzie Vardanyan ◽  
Jillian Gottlieb ◽  
Cathy Wang ◽  
Kevin Delijani ◽  
...  
Keyword(s):  
Multiple Myeloma ◽  
Cell Proliferation ◽  
Protein Expression ◽  
Healthy Subjects ◽  
Progressive Disease ◽  
Mononuclear Cells ◽  
Conflicts Of Interest ◽  
Osteoclast Formation ◽  
Dominant Negative ◽  
Dependent Manner

Abstract Tumor necrosis factor receptor-associated factor 6 (TRAF6) has been implicated in regulating the NF-kB and JNK signal transduction pathways; and, thus, is likely to promote tumor cell proliferation and osteoclast formation. F-box proteins such as the E3 ligase component Fbxo3 and another F-box family member Fbxl 2, regulate TRAF protein signaling. First, we investigated TRAF6 expression in bone marrow mononuclear cells (BMMCs) from multiple myeloma (MM) patients with progressive disease or in remission and healthy subjects.  The results showed higher TRAF6 protein expression among MM patients with progressive disease than among those in remission or healthy subjects. Notably, changes in TRAF6 protein expression in MM BMMCs were found to correlate with response of individual patients to treatment with the proteasome inhibitors bortezomib or carfilzomib. We have previously reported inhibition of MM cell proliferation and increase of apoptosis through regulation of the NF-kB and JNK pathways using a silencing TRAF6 C-domain mRNA construct. In this study, we cloned a 167 amino acid (in residues 333 to 508) portion of the TRAF6 dominant negative (TRAF6dn) and synthesized decoy peptides of the TRAF6 interaction domain with CD40 and the TRAF6-RANK binding domain. Decreases in cell proliferation and increase in cell apoptosis in MM BMMCs treated with TRAF6dn occurred in a concentrationdependent fashion. We also found TRAF6dn markedly inhibited osteoclast cell formation of monocytes induced by RANKL and mCSF in a dose-dependent manner. Next, we examined the effect of TRAF6dn on NF-kB and JNK by determining phosphorylation of JUN kinase kinase (JNKK), which activates the MAP kinase homologues SAPK and JNK in response to IL-1 receptor stimulation. MM BMMCs exposed to the TRAF6dn fragment or TRAF6 decoy peptide showed reduced phosphoNF-kB protein and phosphorylation of JNKK. These studies suggest that the TRAF6dn or combined TRAF6 decoy and CD40 decoy peptide may be excellent agents to block both MM cell growth and osteoclast formation in MM. We further investigated the protein expression of Fbxo 3, Fbxl 2 and TRAF6 in fresh BMMCs from MM patients with progressive disease or in remission. Results of Western blot analysis showed protein expression of Fbxo 3 and TRAF6 was increased and Fbxl 2 was decreased among patients with progressive disease compared to patients in remission. Thus, these results may offer a new mechanism through which MM tumor cells are regulated and provide a new therapeutic approach to treat MM and reduce the clinical consequences resulting from enhanced bone loss that commonly occur in these patients. Disclosures: No relevant conflicts of interest to declare.

LncRNA MALAT-1 Elevates HMGB1 to Promote Autophagy Resulting in Inhibition of Tumor Cell Apoptosis in Multiple Myeloma

2017 ◽  
Vol 118 (10) ◽  
pp. 3341-3348 ◽  
Author(s):  
Da Gao ◽  
Ai-e Lv ◽  
Hui-Ping Li ◽  
Dong-Hai Han ◽  
Ya-Peng Zhang
Keyword(s):  
Multiple Myeloma ◽  
Tumor Cell ◽  
Cell Apoptosis ◽  
Tumor Cell Apoptosis

scholarly journals MicroRNA-126-3p Inhibits Angiogenic Function of Human Lung Microvascular Endothelial Cells via LAT1 (L-Type Amino Acid Transporter 1)-Mediated mTOR (Mammalian Target of Rapamycin) Signaling

2020 ◽  
Vol 40 (5) ◽  
pp. 1195-1206 ◽  
Author(s):  
Danting Cao ◽  
Andrew M. Mikosz ◽  
Alexandra J. Ringsby ◽  
Kelsey C. Anderson ◽  
Erica L. Beatman ◽  
...  
Keyword(s):  
Cell Proliferation ◽  
Endothelial Cells ◽  
Amino Acid ◽  
Cell Apoptosis ◽  
Human Lung ◽  
Mammalian Target Of Rapamycin ◽  
Tube Formation ◽  
Microvascular Endothelial Cells ◽  
Microvascular Endothelial

Objective: MicroRNA-126-3p (miR-126) is required for angiogenesis during organismal development or the repair of injured arterial vasculature. The role of miR-126 in lung microvascular endothelial cells, which are essential for gas exchange and for lung injury repair and regeneration, remains poorly understood. Considering the significant heterogeneity of endothelial cells from different vascular beds, we aimed to determine the role of miR-126 in regulating lung microvascular endothelial cell function and to elucidate its downstream signaling pathways. Approach and Results: Overexpression and knockdown of miR-126 in primary human lung microvascular endothelial cells (HLMVEC) were achieved via transfections of miR-126 mimics and antisense inhibitors. Increasing miR-126 levels in HLMVEC reduced cell proliferation, weakened tube formation, and increased cell apoptosis, whereas decreased miR-126 levels stimulated cell proliferation and tube formation. Whole-genome RNA sequencing revealed that miR-126 was associated with an antiangiogenic and proapoptotic transcriptomic profile. Using validation assays and knockdown approaches, we identified that the effect of miR-126 on HLMVEC angiogenesis was mediated by the LAT1 (L-type amino acid transporter 1), via regulation of mTOR (mammalian target of rapamycin) signaling. Furthermore, downregulation of miR-126 in HLMVEC inhibited cell apoptosis and improved endothelial tube formation during exposure to environmental insults such as cigarette smoke. Conclusions: miR-126 inhibits HLMVEC angiogenic function by targeting the LAT1-mTOR signaling axis, suggesting that miR-126 inhibition may be useful for conditions associated with microvascular loss, whereas miR-126 augmentation may help control unwanted microvascular angiogenesis.

Sign in / Sign up

Export Citation Format

Share Document