Phenotype Analysis and Genetic Study of Chinese Patients With Treacher Collins Syndrome

Objective The aim of this study was to confirm the pathogenic variants, explore the genotype–phenotype correlation and characteristics of Chinese patients with Treacher Collins syndrome (TCS). Design Clinical details of 3 TCS family cases and 2 sporadic cases were collected and analyzed. Whole-exome sequencing and Sanger sequencing were conducted to detect causative variants. Setting Tertiary clinical care. Patients This study included 8 patients clinically diagnosed with TCS who were from 3 familial cases and 2 sporadic cases. Main Outcome Measures When filtering the database, variants were saved as rare variants if their frequency were less than 0.005 in the 1000 Genomes Project Database, the Exome Aggregation Consortium (ExAC) browser, and the Novogene database, or they would be removed as common ones. The pathogenic variants identified were verified by polymerase chain reaction. The sequencing results were analyzed by Chromas 2.1 software. Results Two novel pathogenic variants (NM_000356.3: c.537del and NM_000356.3: c.1965_1966dupGG) and 2 known pathogenic variants (NM_000356.3: c.1535del, NM_000356.3: c.4131_4135del) were identified within TCOF1 which are predicted to lead to premature termination codons resulting in a truncated protein. There was a known missense SNP (NM_015972.3: c.139G>A) within POLR1D. No phenotype–genotype correlation was observed. Instead, these 8 patients demonstrated the high genotypic and phenotypic heterogeneity of TCS. Conclusions This study expands on the pathogenic gene pool of Chinese patients with TCS. Besides the great variation among patients which is similar to international reports, Chinese patients have their own characteristics in clinical phenotype and pathogenesis mutations.

Whole-Exome Sequencing in a Cohort of High Myopia Patients in Northwest China

High myopia (HM) is one of the leading causes of visual impairment worldwide. In order to expand the myopia gene spectrum in the Chinese population, we investigated genetic mutations in a cohort of 27 families with HM from Northwest China by using whole-exome sequencing (WES). Genetic variations were filtered using bioinformatics tools and cosegregation analysis. A total of 201 candidate mutations were detected, and 139 were cosegregated with the disease in the families. Multistep analysis revealed four missense variants in four unrelated families, including c.904C>T (p.R302C) in CSMD1, c.860G>A (p.R287H) in PARP8, c.G848A (p.G283D) in ADAMTSL1, and c.686A>G (p.H229R) in FNDC3B. These mutations were rare or absent in the Exome Aggregation Consortium (ExAC), 1000 Genomes Project, and Genome Aggregation Database (gnomAD), indicating that they are new candidate disease-causing genes. Our findings not only expand the myopia gene spectrum but also provide reference information for further genetic study of heritable HM.

Effect of semaphorin 3C gene variants in multifactorial Hirschsprung disease

Objective Cluster genes, specifically the class 3 semaphorins ( SEMA3) including SEMA3C, have been associated with the development of Hirschsprung disease (HSCR) in Caucasian populations. We aimed to screen for rare and common variants in SEMA3C in Indonesian patients with HSCR. Methods In this prospective clinical study, we analyzed SEMA3C gene variants in 55 patients with HSCR through DNA sequencing and bioinformatics analyses. Results Two variants in SEMA3C were found: p.Val337Met (rs1527482) and p.Val579 = (rs2272351). The rare variant rs1527482 (A) was significantly overrepresented in our HSCR patients (9.1%) compared with South Asian controls in the 1000 Genomes (4.7%) and Exome Aggregation Consortium (ExAC; 3.5%) databases. Our analysis using bioinformatics tools predicted this variant to be evolutionarily conserved and damaging to SEMA3C protein function. Although the frequency of the other variant, rs2272351 (G), also differed significantly in Indonesian patients with HSCR (27.3%) from that in South Asian controls in 1000 Genomes (6.2%) and ExAC (4.6%), it is a synonymous variant and not likely to affect protein function. Conclusions This is the first comprehensive report of SEMA3C screening in patients of Asian ancestry with HSCR and identifies rs1527482 as a possible disease risk allele in this population.

Estimated prevalence of mucopolysaccharidoses from population-based exomes and genomes

Background In this study, the prevalence of different types of mucopolysaccharidoses (MPS) was estimated based on data from the exome aggregation consortium (ExAC) and the genome aggregation database (gnomAD). The population-based allele frequencies were used to identify potential disease-causing variants on each gene related to MPS I to IX (except MPS II). Methods We evaluated the canonical transcripts and excluded homozygous, intronic, 3′, and 5′ UTR variants. Frameshift and in-frame insertions and deletions were evaluated using the SIFT Indel tool. Splice variants were evaluated using SpliceAI and Human Splice Finder 3.0 (HSF). Loss-of-function single nucleotide variants in coding regions were classified as potentially pathogenic, while synonymous variants outside the exon–intron boundaries were deemed non-pathogenic. Missense variants were evaluated by five in silico prediction tools, and only those predicted to be damaging by at least three different algorithms were considered disease-causing. Results The combined frequencies of selected variants (ranged from 127 in GNS to 259 in IDUA) were used to calculate prevalence based on Hardy–Weinberg's equilibrium. The maximum estimated prevalence ranged from 0.46 per 100,000 for MPSIIID to 7.1 per 100,000 for MPS I. Overall, the estimated prevalence of all types of MPS was higher than what has been published in the literature. This difference may be due to misdiagnoses and/or underdiagnoses, especially of the attenuated forms of MPS. However, overestimation of the number of disease-causing variants by in silico predictors cannot be ruled out. Even so, the disease prevalences are similar to those reported in diagnosis-based prevalence studies. Conclusion We report on an approach to estimate the prevalence of different types of MPS based on publicly available population-based genomic data, which may help health systems to be better prepared to deal with these conditions and provide support to initiatives on diagnosis and management of MPS.

Molecular Screening of PROKR2 Gene in Girls with very early Idiopathic Central Precocious Puberty.

Background Prokineticin receptor 2 (PROKR2) loss of function mutations have been described as cause of hypogonadotropic hypogonadism. In 2017 a first case of central precocious puberty (CPP) caused by heterozygous gain of function mutation in PROKR2 was described in a 3.5-year‐old girl. No other cases have been reported yet. This study performs a molecular screening in girls with “early” onset CPP (breast budding before 6 years of age) in order to identify possible alterations in PROKR2.Methods We analyzed DNA of 31 girls with idiopathic CPP diagnosed via basal LH levels > 0.3 IU/L or peak-LH > 5UI/L after stimulation, negative for MKRN3 mutations. The Fisher exact test was used to compare allele frequency of polymorphism found to Exome Aggregation Consortium (ExAC) dataset.Results No rare variants were identified. Five polymorphisms were found (rs6076809, rs8116897, rS3746684, rs3746682, rs3746683). All except one (i.e. rs3746682) had a minor allele frequency similar to that reported in literature. rs3746682 presented a minor allele frequency higher than described in The Exome Aggregation Consortium (ExAC) (0.84 in our population vs 0.25 from ExAC).Conclusions As for other G-protein-coupled receptors (i.e. GPR54), mutations in PROKR2 do not seem to be a frequent cause of CPP in girls.

Brazilian cohort and genes encoding for drug-metabolizing enzymes and drug transporters

Background & aim: Genetic variability in drug absorption, distribution, metabolism and excretion (ADME) genes contributes to the high heterogeneity of drug responses. The present study investigated polymorphisms of ADME genes frequencies and compared the findings with populations from other continents, available in the 1000 Genome Project (1 KGP) and the Exome Aggregation Consortium (ExAC) databases. Methodology & results: We conducted a study of 100 patients in Brazil and a total of 2003 SNPs were evaluated by targeted next-generation sequencing in 148 genes, including Phase I enzymes (n = 50), Phase II enzymes (n = 38) and drug transporters (n = 60). Overall, the distribution of minor allele frequency (MAF) suggests that the distribution of 2003 SNPs is similar between Brazilian cohort, 1 KGP and ExAC; however, we found moderate SNP allele-frequency divergence between Brazilian cohort and both 1000 KGP and ExAC. These differences were observed in several relevant genes including CYP3A4, NAT2 and SLCO1B1. Conclusion: We concluded that the Brazilian population needs clinical assessment of drug treatment based on individual genotype rather than ethnicity.

Homozygous mutations in DZIP1 can induce asthenoteratospermia with severe MMAF

BackgroundAsthenoteratospermia, one of the most common causes for male infertility, often presents with defective sperm heads and/or flagella. Multiple morphological abnormalities of the sperm flagella (MMAF) is one of the common clinical manifestations of asthenoteratospermia. Variants in several genes including DNAH1, CEP135, CATSPER2 and SUN5 are involved in the genetic pathogenesis of asthenoteratospermia. However, more than half of the asthenoteratospermia cases cannot be explained by the known pathogenic genes.Methods and resultsTwo asthenoteratospermia-affected men with severe MMAF (absent flagella in >90% spermatozoa) from consanguineous families were subjected to whole-exome sequencing. The first proband had a homozygous missense mutation c.188G>A (p.Arg63Gln) of DZIP1 and the second proband had a homozygous stop-gain mutation c.690T>G (p.Tyr230*). Both of the mutations were neither detected in the human population genome data (1000 Genomes Project, Exome Aggregation Consortium) nor in our own data of a cohort of 875 Han Chinese control populations. DZIP1 encodes a DAZ (a protein deleted in azoospermia) interacting protein, which was associated with centrosomes in mammalian cells. Immunofluorescence staining of the centriolar protein Centrin1 indicated that the spermatozoa of the proband presented with abnormal centrosomes, including no concentrated centriolar dot or more than two centriolar dots. HEK293T cells transfected with two DZIP1-mutated constructs showed reduced DZIP1 level or truncated DZIP1. The Dzip1-knockout mice, generated by the CRSIPR-Cas9, revealed consistent phenotypes of severe MMAF.ConclusionOur study strongly suggests that homozygous DZIP1 mutations can induce asthenoteratospermia with severe MMAF. The deficiency of DZIP1 induces sperm centrioles dysfunction and causes the absence of flagella.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family

Background Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. Methods We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. Results Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. Conclusion Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Genetic Polymorphisms of Pharmacogenomic VIP Variants in the Circassian Subpopulation from Jordan

Background: It has been suggested that genetic variation within candidate pharmacogenes contributes to the differences in drug safety and efficacy as well as risk of adverse drug reactions among different ethnic groups. Illustrating the polymorphic distribution of Very Important Pharmacogenes (VIPs) in various ethnic groups will contribute to the development of personalized medicine for those populations. Objective: The present study aimed to identify the polymorphic distribution of VIPs in the Circassian subpopulation of Jordan and compare their allele frequencies with those of other populations. Methods: A total of 130 healthy and unrelated Circassian adults from Jordan were randomly recruited and genotyped for eleven VIP variants within the thiopurine S-methyltransferase (TPMT), ATP-binding cassette, sub-family B, member 1 (ABCB1), and vitamin D receptor (VDR) genes via Sequenom’s MassARRAY® genotyping platform (iPLEX GOLD). Results: Our data on the allelic frequencies of the investigated VIP variants were compared to those of 18 other populations, comprising 11 HapMap populations, 6 Exome Aggregation Consortium populations, and the Chechen- Jordanian population from Jordan. Circassian-Jordanians were found to most resemble the African, Chechen- Jordanian, European (Finnish), European (non-Finnish), and South-Asian populations. Conclusion: Circassians from Jordan significantly differ from other populations in terms of the allelic frequencies of selected VIP variants. The present findings constitute the first set of pharmacogenetic data for Circassian population from Jordan, providing a basis for safe drug administration that may be useful in diagnosing and treating diseases in this ethnic group.