The importance of coconut seedling production in guyana

The demand for coconut water and coconut oil is increasing thus there is interest in expanding coconut cultivation. Coconut is primarily planted on approximately 28,500 acres by more than 1,400 farmers along the Guyana coastline with the Atlantic Ocean and in the Pomeroon Riverain area. Tall types (e.g. Jamaica Tall) are planted for oil while Dwarf types (e.g. Malaysian Dwarf Green, Suriname Brown) are planted primarily for water. At least 50% of the Tall type population is more than 50 years old and needs to be replanted to increase productivity. Farmers traditionally collect seedlings growing from dropped nuts at the base of trees without attention to prolificacy. Since a coconut tree productive life is more than 50 years, the economic impact of this practice can be significant. Via training programs, CARDI is encouraging the structured production of coconut seedlings to increase yields. This project aims to enhance the supply of quality seedlings using local seed nuts. Mother palms that display prolific bearing habits, resistance to pest and diseases plus vigorous growth habit were geotagged and recorded in a database. Seed nuts were purchased from farmers who own these trees and subsequently distributed (in batches of 400) to ten selected (age, gender, location) lead farmers to establish coconut seedling nurseries. Each lead farmer was assisted by 10 second ring farmers in the establishment of their nurseries under CARDI supervision. Results to date show that weed control and irrigation were important nursery activities. Some nurseries needed to be fenced to counter damage by animals (cows, sheep, goats). Average germination of seed nuts was approximately 50%. Available seedlings are being distributed to second ring farmers and lead farmers. CARDI will continue the national survey to identify outstanding mother palms. Measures to increase average germination must also be implemented. Local coconut seedling nurseries should therefore be encouraged as their “success” will alleviate the pressure to import seed nuts thus avoiding the attendant risk of introducing exotic diseases (e.g. lethal yellowing disease) into Guyana. Further, given that a coconut palm will live 50 to 70 years, the importance of carefully selecting premium quality coconut seedlings as a bedrock to develop and grow the industry cannot be over emphasized.

The importance of coconut seedling production in Guyana

The demand for coconut water and coconut oil is increasing thus there is interest in expanding coconut cultivation. Coconut is primarily planted on approximately 28,500 acres by more than 1,400 farmers along the Guyana coastline with the Atlantic Ocean and in the Pomeroon Riverain area. Tall types (e.g. Jamaica Tall) are planted for oil while Dwarf types (e.g. Malaysian Dwarf Green, Suriname Brown) are planted primarily for water. At least 50% of the Tall type population is more than 50 years old and needs to be replanted to increase productivity. Farmers traditionally collect seedlings growing from dropped nuts at the base of trees without attention to prolificacy. Since a coconut tree productive life is more than 50 years, the economic impact of this practice can be significant. Via training programs, CARDI is encouraging the structured production of coconut seedlings to increase yields. This project aims to enhance the supply of quality seedlings using local seed nuts. Mother palms that display prolific bearing habits, resistance to pest and diseases plus vigorous growth habit were geotagged and recorded in a database. Seed nuts were purchased from farmers who own these trees and subsequently distributed (in batches of 400) to ten selected (age, gender, location) lead farmers to establish coconut seedling nurseries. Each lead farmer was assisted by 10 second ring farmers in the establishment of their nurseries under CARDI supervision. Results to date show that weed control and irrigation were important nursery activities. Some nurseries needed to be fenced to counter damage by animals (cows, sheep, goats). Average germination of seed nuts was approximately 50%. Available seedlings are being distributed to second ring farmers and lead farmers. CARDI will continue the national survey to identify outstanding mother palms. Measures to increase average germination must also be implemented. Local coconut seedling nurseries should therefore be encouraged as their “success” will alleviate the pressure to import seed nuts thus avoiding the attendant risk of introducing exotic diseases (e.g. lethal yellowing disease) into Guyana. Further, given that a coconut palm will live 50 to 70 years, the importance of carefully selecting premium quality coconut seedlings as a bedrock to develop and grow the industry cannot be over emphasized.

The American Palm Cixiid, Haplaxius crudus

The American palm cixiid, Haplaxius crudus, is a common species of insect that belongs to the order Hemiptera, family Cixiidae. It is widespread and abundant in the state of Florida, but also occurs as far north as South Carolina and as far west as Texas. Furthermore, it is common throughout the Caribbean basin. This insect feeds on a wide variety of palm species as adults while the immature stages feed on a wide variety of grass species. This species is of high economic concern due to its ability to transmit the lethal yellowing (LY) phytoplasma (Howard and Thomas 1980) and is also the putative vector of lethal bronzing (LB) in Florida. Major revision of Howard, Forrest. 2007. “American Palm Cixiid, Myndus Crudus Van Duzee (Insecta: Hemiptera: Auchenorrhyncha: Fulgoroidea: Cixiidae)”. EDIS 2007 (10). https://journals.flvc.org/edis/article/view/116586. Revised 2015.

First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrXXIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

Haplaxius crudus (American palm cixiid).

Haplaxius crudus, commonly known as American palm cixiid, is native to the American tropics and subtropics. The species was first described from Jamaica in 1907 and is currently known from northern South America, Central America, certain islands of the Caribbean, and Florida and southern Texas in the USA. The adults of H. crudus feed mainly on palms, particularly coconut palms, while the nymphs feed mainly on grasses. The main economic impact of H. crudus is as a vector of coconut (or palm) lethal yellowing (LY) caused by Candidatus Phytoplasma palmae, a highly destructive disease that affects at least 37 species of palms, including coconut palm (Cocos nucifera) and date palm (Phoenix dactylifera). Control of LY is best achieved by the planting of resistant cultivars integrated with cultural measures such as ground cover management because chemical control of H. crudus is not practical. International trade in palms from LY-infected areas is prohibited because of the threat of the disease and vector spreading not only to coconuts and date palms, but also to palms that are important as ornamental plants or as local sources of food or fibre.

Candidatus Phytoplasma palmae (lethal yellowing (LY)).

The Atlantic tall, the most prevalent coconut ecotype throughout the Caribbean region and Atlantic coast of the Americas (Harries, 1978a), is highly susceptible to LY disease. During the past three decades, at least 50% of Florida's estimated one million coconut palms and over 80% of Jamaica's five million coconut palms have been eliminated by LY (McCoy et al., 1983). Similar epidemic losses of coconut to LY continued along the Atlantic coasts of southern Mexico and Honduras (Oropeza and Zizumbo, 1997). Although rarely affecting palms less than 5 years old, the disease prevents any re-establishment of highly susceptible coconut ecotypes in LY-endemic locations such as Florida and Jamaica.

A new species of planthopper in the genus Patara (Hemiptera: Derbidae) on coconut palm (Cocos nucifera) from the island of Barbuda

The island of Barbuda was recently surveyed for the presence of Haplaxius crudus to establish the risk of Lethal Yellowing to palms on the island. After extensive collecting, H. crudus was not found on the island. A new species of Patara Westwood was found on coconut palms on the southwest portion of Barbuda. Herein, we describe the new species as Patara cooki sp. n. and provide DNA sequence data for cytochrome c oxidase subunit I (COI) and 18S genes for it and Patara guttata Westwood. Patara cooki differed from Patara guttata sp. n. by 1.8% for 18S and 7.8% for COI, similar to intrageneric differences reported for other taxa. A phylogenetic analysis of available Otiocerinae near Patara using found Patara cooki sp. n. nested among other Patara species. We also offer commentary regarding the interpretation of forewing venation in Patara.

The Complete Mitochondrial Genome of the American Palm Cixiid, Haplaxius crudus (Hemiptera: Cixiidae)

Haplaxius crudus Van Duzee is a pest of various economically important palms due to its ability to transmit lethal yellowing, a fatal phytoplasma infection. It is also the putative vector of lethal bronzing in Florida, another lethal phytoplasma disease causing significant economic losses. To date, no mitochondrial genomes for species in the family Cixiidae are sequenced. In this study, the complete mitochondrial genome of H. crudus was sequenced, assembled, and annotated from PacBio Sequel II long sequencing reads using the University of Florida’s HiPerGator. The mitogenome of H. crudus is 15,848 bp long and encodes 37 mitochondrial genes (including 13 protein-coding genes (PCGs), 22 tRNAs, and 2 rRNAs) in addition to a putative noncoding internal control region. The nucleotide composition of H. crudus is asymmetric with a bias toward A/T (44.8 %A, 13.4 %C, 8.5 %G, and 33.3 %T). Protein-coding genes (PCGs) possess the standard invertebrate mitochondrial start codons with few exceptions while the gene content and order of the H. crudus mitogenome is highly similar to most completely sequenced insect mitochondrial genomes. Phylogenetic analysis based on the entire mitogenome shows H. crudus resolving closely to Delphacidae, the accepted sister taxon of Cixiidae. These data provide a useful resource for developing novel primer sets that could aid in either phylogenetic studies or population genetic studies. As more full mitogenomes become available in the future for other planthopper species, more robust phylogenies can be constructed, giving more accurate perspectives on the evolutionary relationships within this fascinating and economically important group of insects.