scholarly journals First report of 'CandidatusLiberibacter solanacearum' in Jerusalem cherry (Solanum pseudocapsicum)and thorn-apple (Datura stramonium) in New Zealand

2015 ◽  
Vol 32 ◽  
pp. 1 ◽  
Author(s):  
J. Vereijssen ◽  
N.M. Taylor ◽  
A.M. Barnes ◽  
S.E. Thompson ◽  
D.P. Logan ◽  
...  
Keyword(s):  
New Zealand ◽  
Datura Stramonium ◽  
First Report ◽  
Thorn Apple

scholarly journals First report of the Australian brown algaDictyota furcellata(C. Agardh) Grev. from New Zealand

2004 ◽  
Vol 38 (1) ◽  
pp. 129-135 ◽  
Author(s):  
W. A. Nelson ◽  
K. F. Neill ◽  
J. A. Phillips
Keyword(s):  
New Zealand ◽  
First Report

Theileria orientalis, a blood parasite of cattle. first report in New Zealand

1984 ◽  
Vol 32 (9) ◽  
pp. 154-156 ◽  
Author(s):  
M.P. James ◽  
B.W. Saunders ◽  
Leslie A. Guy ◽  
E.O. Brookbanks ◽  
W.A.G. Charleston ◽  
...  
Keyword(s):  
New Zealand ◽  
Blood Parasite ◽  
Theileria Orientalis ◽  
First Report

Allelopathic potential of Datura stramonium L. (Thorn-apple)

Weed Research ◽  
1981 ◽  
Vol 21 (3-4) ◽  
pp. 165-170 ◽  
Author(s):  
J. V. LOVETT ◽  
JUDY LEVITT ◽  
A. M. DUFFIELD ◽  
N.G. SMITH
Keyword(s):  
Datura Stramonium ◽  
Allelopathic Potential ◽  
Thorn Apple

scholarly journals First report of Diplodia africana from Fraxinus excelsior in New Zealand

2021 ◽  
Vol 44 (2) ◽  
Author(s):  
K. Dobbie ◽  
J. Baskarathevan ◽  
T. Waters ◽  
R. O'Neill
Keyword(s):  
New Zealand ◽  
Fraxinus Excelsior ◽  
First Report

scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

scholarly journals First Report of Spiranthes mosaic virus 3 in Phlox spp. in New Zealand

Plant Disease ◽  
2017 ◽  
Vol 101 (5) ◽  
pp. 849-849 ◽  
Author(s):  
J. Tang ◽  
S. Khan ◽  
B. Quinn ◽  
S. Veerakone ◽  
E. Milleza ◽  
...  
Keyword(s):  
New Zealand ◽  
Mosaic Virus ◽  
First Report

scholarly journals First Report of a Leaf Spot Disease Caused by Alternaria protenta on the Datura stramonium in Serbia

Plant Disease ◽  
2020 ◽  
Vol 104 (3) ◽  
pp. 986-986
Author(s):  
J. Blagojević ◽  
S. Janjatović ◽  
M. Ignjatov ◽  
N. Trkulja ◽  
K. Gašić ◽  
...  
Keyword(s):  
Leaf Spot ◽  
Datura Stramonium ◽  
Leaf Spot Disease ◽  
First Report ◽  
Spot Disease

scholarly journals First Report of Turnip yellows virus in Daphne odora in New Zealand

Plant Disease ◽  
2018 ◽  
Vol 102 (7) ◽  
pp. 1467-1467
Author(s):  
S. Veerakone ◽  
J. Tang ◽  
A. Zheng ◽  
L. I. Ward
Keyword(s):  
New Zealand ◽  
First Report ◽  
Turnip Yellows Virus ◽  
Daphne Odora

Phylogeography of Neopurcellia salmoni, a widespread mite harvestman from the South Island of New Zealand, with the first report of male polymorphism in the suborder Cyphophthalmi (Arachnida: Opiliones)

2021 ◽  
Vol 49 (2) ◽  
Author(s):  
Pietro Tardelli Canedo ◽  
Caitlin M. Baker ◽  
Rina Morisawa ◽  
Eliza J. Pessereau ◽  
Sarah L. Boyer
Keyword(s):  
New Zealand ◽  
The South ◽  
First Report ◽  
Male Polymorphism
Sign in / Sign up

Export Citation Format

Share Document