First Report of Epicoccum layuense Causing Leaf Brown Spot on Camellia oleifera in Hefei, China

Camellia oleifera, a major tree species for producing edible oil, is originated in China. Its oil is also called ‘‘eastern olive oil’’ with high economic value due to richness in a variety of healthy fatty acids (Lin et al. 218). However, leaves are susceptible to leaf spot disease (Zhu et al. 2014). In May 2021, we found circular to irregular reddish-brown lesions, 4-11 mm in diameter, near the leaf veins or leaf edges on 30%-50% leaves of 1/3 oil tea trees in a garden of Hefei City, Anhui Province, China (East longitude 117.27, North latitude 31.86) (Figure S1 A). To isolate the causal agents, symptomatic leaves were cut from the junction of diseased and healthy tissues (5X5 mm) and treated with 70 % alcohol for 30 secs and 1 % NaClO for 5 min, and subsequently inoculated onto PDA medium for culture. After 3 days, hyphal tips were transferred to PDA. Eventually, five isolates were obtained. Then the isolates were cultured on PDA at 25°C for 7 days and the mycelia appeared yellow with a white edge and secreted a large amount of orange-red material to the PDA (Figure S1 B and C). Twenty days later, the mycelium appeared reddish-brown, and sub-circular (3-10 mm) raised white or yellow mycelium was commonly seen on the Petri dish, and black particles were occasionally seen. Meanwhile, the colonies on the PDA produced abundant conidia. Microscopy revealed that conidia were globular to pyriform, dark, verrucose, and multicellular with 14.2 to 25.3 μm (=19.34 μm, n = 30) diameter (Figure S1 D). The morphological characteristics of mycelial and conidia from these isolates are similar to that of Epicoccum layuense (Chen et al.2020). To further determine the species classification of the isolates, DNA was extracted from 7-day-old mycelia cultures and the PCR-amplified fragments were sequenced for internal transcribed spacer (ITS), beta-tubulin and 28S large subunit ribosomal RNA (LSU) gene regions ITS1/ITS4, Bt2a/Bt2b and LR0R/LR5, followed by sequencing and molecular phylogenetic analysis of the sequences analysis (White et al. 1990; Glass and Donaldson 1995; Vilgalys and Hester 1990). Sequence analysis revealed that ITS, beta-tubulin, and LSU divided these isolates into two groups. The isolates AAU-NCY1 and AAU-NCY2, representing the first group (AAU-NCY1 and AAU-NCY5) and the second group (AAU-NCY2, AAU-NCY3 and AAU-NCY4), respectively, were used for further studies. Based on BLASTn analysis, the ITS sequences of AAU-NCY1 (MZ477250) and AAU-NCY2 (MZ477251) showed 100 and 99.6% identity with E. layuense accessions MN396393 and KY742108, respectively. And, the beta-tubulin sequences (MZ552310; MZ552311) showed 99.03 and 99.35% identity with E. layuense accessions MN397247 and MN397248, respectively. Consistently, their LSU (MZ477254; MZ477255) showed 99.88 and 99.77% identity with E. layuense accessions MN328724 and MN396395, respectively. Phylogenetic trees were built by maximum likelihood method (1,000 replicates) using MEGA v.6.0 based on the concatenated sequences of ITS, beta-tubulin and LSU (Figure S2). Phylogenetic tree analysis confirmed that AAU-NCY1 and AAU-NCY2 are closely clustered with E. layuense stains (Figure S2). To test the pathogenicity, conidial suspension of AAU-NCY2 (106 spores/mL) was prepared and sterile water was used as the control. Twelve healthy leaves (six for each treatment) on C. oleifera tree were punched with sterile needle (0.8-1mm), the sterile water or spore suspension was added dropwise at the pinhole respectively (Figure S1 E and F). The experiment was repeated three times. By ten-day post inoculation, the leaves infected by the conidia gradually developed reddish-brown necrotic spots that were similar to those observed in the garden, while the control leaves remained asymptomatic (Figure S1 G and H). DNA sequences derived from the strain re-isolated from the infected leaves was identical to that of the original strain. E. layuense has been reported to cause leaf spot on C. sinensis (Chen et al. 2020), and similar pathogenic phenotypes were reported on Weigela florida (Tian et al. 2021) and Prunus x yedoensis Matsumura in Korea ( Han et al. 2021). To our knowledge, this is the first report of E. layuense causing leaf spot on C. oleifera in Hefei, China.

The Effect of Tau and Taxol on Polymerization of MCF7 Microtubules In Vitro

Overexpression of Tau protein in breast cancer cells is identified as an indicator for potential resistance to taxane-based therapy. As reported findings have been obtained mostly from clinical studies, the undetermined underlying mechanism of such drug resistance needs to be thoroughly explored through comprehensive in vitro evaluations. Tau and Taxol bind to the beta tubulin site in microtubules’ structure. This is of particular interest in breast cancer, as microtubules of these cancer cells are structurally distinct from some other microtubules, such as neuronal microtubules, due to their unique beta tubulin isotype distribution. The observed changes in the in vitro polymerization of breast cancer microtubules, and the different function of some molecular motors along them, leave open the possibility that the drug resistance mechanism can potentially be associated with different responses of these microtubules to Tau and Taxol. We carried out a series of parallel experiments to allow comparison of the in vitro dual effect of Tau and Taxol on the polymerization of MCF7 microtubules. We observed a concentration-dependent demotion-like alteration in the self-polymerization kinetics of Tau-induced MCF7 microtubules. In contrast, microtubules polymerized under the simultaneous effects of Tau and Taxol showed promoted assembly as compared with those observed in Tau-induced microtubules. The analysis of our data obtained from the length of MCF7 microtubules polymerized under the interaction with Tau and Taxol in vitro suggests that the phenomenon known as drug resistance in microtubule-targeted drugs such as Taxol may not be directly linked to the different responses of microtubules to the drug. The effect of the drug may be mitigated due to the simultaneous interactions with other microtubule-associated proteins such as Tau protein. The observed regulatory effect of Tau and Taxol on the polymerization of breast cancer microtubules in vitro points to additional evidence for the possible role of tubulin isotypes in microtubules’ functions.

First Report of Lasiodiplodia pseudotheobromae Causing Collar Rot of Peanut in Shandong Province, China

In August 2019, a collar rot of peanut was observed in several fields in Qingdao, Shandong province, China. Disease survey was conducted in several peanut fields. Less than 5% plants exhibited various symptoms, including brown or black stem rot, pod rot, leaf chlorotic, wilted, and even dead. Symptomatic stems were cut into small pieces, surface disinfested with 70% ethanol for 1 min, 1% NaClO for 2 minutes, rinsed three times with sterile water, and dried on sterile filter papers. Pieces then were plated on potato dextrose agar (PDA) media and incubated at 25°C in darkness. Fungal cultures were initially white, then turned gray, and eventually turned black, and aerial hyphae were dense, fluffy. Conidia were ellipsoidal, initially hyaline, unicellular, 14.3 to 21.1 × 8.7 to 13.2 µm (n = 50), and mature conidia showed dark brown, with a central septum, and longitudinal stripes. Molecular identification was performed by sequencing ITS with ITS1/ITS4 (White et al., 1990) and beta tubulin gene with Bt2a/Bt2b (Glass and Donaldson, 1995) of a representative isolate ZHX9. ITS and beta tubulin regions (OK427342 and OK489788) of ZHX9 obtained 99.62 and 100% similar to L. pseudotheobromae (KF766193 and EU673111), respectively. Phylogenetic analysis was done using Neighbor-Joining (NJ) analysis based on those gene sequences. The microorganism we have isolated was identified as L. pseudotheobromae based on molecular analysis and morphological characteristics. For pathogenicity assay, twelve ten-days-old peanut (Zhonghua No.12) seedlings were each inoculated with one mycelial plug (8 mm in diameter) by placing the inoculum on the base of the stem. Twelve plants were each inoculated with a plug of non-colonized PDA as controls. Plants were incubated in a growth chamber (30°C in the day and 25°C at night, a 12-h photoperiod and 80% RH). Necrotic lesions were observed on stems of all inoculated seedlings 5 days after inoculation, whereas control plants remained asymptomatic, and L. peudotheobromae was consistently re-isolated from symptomatic stem. In Asia, peanut collar rot caused by L. teudotheobromae has been reported in India, Indonesia, North Vietnam (Nguyen, et al., 2006) and China (Guo, et al., 2014), but collar rot caused by L. pseudotheobromae has not been reported. To our knowledge, this is the first report of L. peudotheobromae causing collar rot on peanut in China. These results will provide crucial information for studying on epidemiology and management of this disease.

Monitoring benzimidazole resistance in Phyllosticta citricarpa using a molecular assay targeting mutations in codons 198 and 200 of the beta-tubulin gene

Citrus black spot (CBS), caused by Phyllosticta citricarpa, is an economically important disease, which is effectively controlled by repeated fungicide applications to protect fruit from infection. Systemic fungicides such as benzimidazoles are widely used for controlling CBS in South Africa, but the molecular mechanisms of benzimidazole resistance in P. citricarpa had not been investigated. Analysis of the nucleotide sequence of the beta-tubulin gene in P. citricarpa revealed mutations inducing three amino acid replacements in benzimidazole-resistant isolates when compared to that of sensitive strains. Amino acid replacements in benzimidazole-resistant isolates included the change of glutamic acid to either alanine or lysine at codon 198 of the beta-tubulin gene and the change from phenylalanine to tyrosine at codon 200. All three mutations were previously implicated in benzimidazole resistance in several fungal pathogens. A polymerase chain reaction (PCR) assay was designed to amplify a portion of the beta-tubulin gene, which is subsequently sequenced to identify benzimidazole resistance in P. citricarpa. This PCR and sequence assay was found to be a more rapid and reliable method for detecting resistance compared to the fungicide-amended plate tests and is valuable for monitoring the occurrence of benzimidazole-resistant P. citricarpa and for assessment of the need for alternative CBS management practices.

Development of Droplet Microfluidics Capable of Quantitative Estimation of Single-Cell Multiplex Proteins

This study presented constriction microchannel based droplet microfluidics realizing quantitative measurements of multiplex types of single-cell proteins with high throughput. Cell encapsulation with evenly distributed fluorescence labelled antibodies stripped from targeted proteins by proteinase K was injected into the constriction microchannel with the generated fluorescence signals captured and translated into protein numbers leveraging the equivalent detection volume formed by constriction microchannels in both droplet measurements and fluorescence calibration. In order to form the even distribution of fluorescence molecules within each droplet, the stripping effect of proteinase K to decouple binding forces between targeted proteins and fluorescence labelled antibodies was investigated and optimized. Using this microfluidic system, binding sites for beta-actin, alpha-tubulin, and beta-tubulin were measured as 1.15±0.59×106, 2.49±1.44×105, and 2.16±1.01×105 per cell of CAL 27 (N cell=15486), 0.98±0.58×106, 1.76±1.34×105 and 0.74±0.74×105 per cell of Hep G2 (N cell=18266). Neural net pattern recognition was used to differentiate CAL 27 and Hep G2 cells, producing successful rates of 59.4% (beta-actin), 64.9% (alpha-tubulin), 88.8% (beta-tubulin), and 93.0% in combination, validating the importance of quantifying multiple types of proteins. As a quantitative tool, this approach could provide a new perspective for single-cell proteomic analysis.

Boeremia exigua Causes Leaf Spot of Walnut Trees (Juglans regia) in China

Walnuts are an important perennial nut crop widely cultivated in China, which are rich in protein, carbohydrate, renieratene, and other beneficial nutrients. China is the largest producer of walnuts in the world, with the largest planting area and output. At the end of April 2020, several unknown necrotic spots on leaves of walnut trees were observed in a Juglans regia field located in Sancha Town, Enshi, China (30°28′N, 109°64′E). Initially, lesions were black, small, sunken, and turning to yellowish-brown, irregular, well surrounded by brown margins. Severely, leaf spots coalesced and resulted in withered and abscised. In order to identify the pathogen, infected leaves were collected. Sections of leaves were aseptically excised from the margins of necrotic spots following surface sterilization and placed on potato dextrose agar (PDA) at 28℃. After 4 days, fungal isolates were obtained and purified by hyphal tip isolation. The isolates looked morphologically similar, producing colonies that appeared hyphae with dark grey, lobed margins, and aerial mycelium with white to light gray. After 15 days of incubation, subglobose, dark brown pycnidia (100-176 μm in wide, 75-95 μm in length) were formed with an orifice in the center, producing conidia. Conidia (3.5 to 9.0 × 1.6 to 4.5 μm) were oval to round, aseptate, occasionally 1-septate. These morphological characteristics lead to the conclusion that the isolates may be identified as Phoma sp. (Boerema et al. 1976). A single isolate was randomly selected and designated for further verification. To confirm the identity, the internal transcribed spacer region (ITS), actin (ACT) and beta-tubulin genes were amplified and sequenced ITS1/ITS4, ACT-512F/ACT-783R, and Bt2a/Bt2b, respectively (White et al. 1990, Groenewald et al. 2013). BLAST analysis of the ITS 505-bp sequence (GenBank accession no. MW282913), actin 269-bp sequence (GenBank accession no. MW201958), and beta-tubulin 347-bp sequence (GenBank accession no. MW273782) showed ≥99% homology with the sequences of B. exigua available in GenBank (GenBank accession no. AB454232, LT158234, and KR010463, respectively). Base on the above results, the strain HTY2 was identified as B. exigua. Pathogenicity was tested. Walnut plants were spray-inoculated with a spore suspension (5 x 105 CFU/mL). Controls were inoculated as described above except that sterile distilled water in the dark at 25 ℃. After seven days, lesions were evident at inoculation points, and equivalent to those observed in field were observed. Control leaves remained symptomless. The pathogenicity test was repeated thrice and the results were the same, fulfilling the Koch’s postulates. The pathogen has been reported on various plants around the world, causing a series of symptoms. Infected plants rarely died, but the presence of lesions decreased their fruit quality and yield. Previous identification of the disease is essential in formulating management strategies.

First report of Neofusicoccum parvum causing canker on Castanea sativa in Spain

In April 2021, depressed bark with dark reddish coloration was observed on the stem of a five-year-old chestnut (Castanea sativa Mill.) plant, acquired from a commercial Galician nursery. One tissue sample was collected from the injury of this plant, surface-sterilized with 96% ethanol for 30 s and dried on sterilized tissue paper, plated on potato dextrose agar (PDA) and incubated at 25ºC. Fungal colonies were consistently isolated and after 5 days developed abundant greyish-white aerial mycelium. Two weeks later pycnidia with fusiform conidia were observed. For molecular identification, internal transcribed spacer (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTAT TGATATGC, White et al. 1990), beta-tubulin (BT2a: GGTAACCAAATCGGT GCTGCTTTC, BT2b: ACCCTCAGTGTAGTGACCCTTGGC, Glass & Donaldson 1995) and elongation factor (EF1-728F: CATCGA GAAGTTCGAGAAGG, EF1-1199R: GGGAAGTACCMGTGATCATGT, Walker et al. 2010) were amplified. BLAST analysis showed that ITS sequence of isolate LPPAF-971 (accession no. MZ314849) showed 99.63% identity with Neofusicoccum parvum isolates ACBA15 (accession no. KX244803) and mywxxq (accession no. MW767713), and 99.4% identity with isolate CMW9081T (accession no. AY230943). Beta-tubulin sequence (accession no. MZ561053) showed 100% identity with isolate GDTCMF1 (accession no. MN022786), and elongation factor sequence (accession no. MZ561054) showed 98.70% identity with isolate F7 (accession no. MN461166), all corresponding with N. parvum. Pathogenicity tests were carried out on ten five-year-old chestnut plants on which a 5mm PDA plug from the edge of an actively growing colony of the fungus was inoculated by a cut in the bark of one to three branches per plant up to a total of 16 inoculated branches and then wrapped with Parafilm©. Five plants inoculated with one plug of PDA without the fungus were used as controls. Plants were placed in a plastic tunnel with a lateral insect net, provided with drip irrigation and grown under natural conditions. Bark cankers symptoms similar to the one observed in the original sample were visible on all inoculated chestnut plants ten days after inoculation. No symptoms were observed on the controls. The assay was conducted twice. Fungal colonies morphologically identified as N. parvum were reisolated from bark cankers on inoculated chestnut plants, fulfilling Koch’s postulates. C. sativa is a widely distributed multipurpose tree, with important economic, environmental, cultural, and heritage functions (Bounous & Beccaro 2019), which underlines the importance of this finding with a view on its sanitary control. In addition, N. parvum, teleomorph Botryosphaeria parva (Pennycook & Samuels) Crous, Slippers & Phillips (Crous et al. 2006), is the causal agent of cankers and dieback in many crops and trees (Phillips et al. 2013) worldwide, but until now it had not been detected in C. sativa. To the best of our knowledge, this is the first report worldwide of N. parvum causing disease on chestnut in Spain. References: Bounous G & Beccaro G. 2019. Pp. 1. In: The Chestnut Handbook-Crop & Forest Management. Eds. Beccaro et al. CRC Press, Taylor & Francis Group. Crous PW et al. 2006. Stud. Mycol. 55: 235. doi.org/10.3114/sim.55.1.235 Glass NL & Donaldson GC. 1995. Appl Environ Microbiol 61: 1323. doi: 10.1128/aem.61.4.1323-1330 Phillips AJL et al. 2013. Stud. Mycol. 76: 51. doi:10.3114/sim0021 Walker DM et al. 2010. Mycologia 102: 1479. doi: 10.3852/10-002 White TJ et al. 1990. Pp. 315 In: PCR Protocols: a guide to methods and applications. Academic Press, San Diego, CA.