necrotic spots
Recently Published Documents


TOTAL DOCUMENTS

169
(FIVE YEARS 13)

H-INDEX

15
(FIVE YEARS 0)

2021 ◽  
Vol 4 (3) ◽  
pp. 37-44
Author(s):  
R. A. Abdullaev ◽  
N. V. Alpatieva ◽  
T. V. Lebedeva ◽  
O. N. Kovaleva ◽  
E. E. Radchenko ◽  
...  

Background. The search for barley (Hordeum vulgare L.) genotypes that carry effective genes for resistance to powdery mildew agent Blumeria graminis f. sp. hordei is a present-day issue for Russian plant breeding. The mlo11 allele that confers long-term protection of barley against the pathogen is rarely found among the varieties, approved for cultivation in the territory of Russia. There is no information on the occurrence among Russian varieties of another effective allele, mlo11 (cnv2), therefore, the search for its source is a current necessity. Materials and methods. Seven barley accessions from Ethiopia and 7 accessions from Japan have been tested for resistance to the northwestern population of the powdery mildew agent in the field and in laboratory conditions. To identify of the Mlo gene alleles, nucleotide sequences of the Stowaway-MITE (Miniature Inverted-repeat Transposable Elements) and the adjacent promoter fragments were determined. Results. Phytopathological tests in the field and greenhouse conditions, as well as molecular markers were used to study 14 barley accessions from Ethiopia and Japan. According to the preliminary tests, plants were resistant to powdery mildew. The highly effective allele of powdery mildew resistance mlo11 (cnv2) was for the first time identified in four barley accessions from Ethiopia, k-20087, k-20523, k-20524 and k-28126. Under field conditions, adult plants were resistant, and in the greenhouse they were moderately damaged by powdery mildew (1-2 points). The disease symptoms were similar to those described for the sample Eth295, a carrier of the mlo11(cnv2) allele variant: single pustules and the absence of necrotic spots on the leaves. The fragments of Stowaway-MITE and adjacent Mlo 5' promoter sequences were amplified in all 14 accessions. The amplicons were cloned and sequenced. The unique marker SNPs within the MITE and Mlo 5’ promoter sequences, i.e. the substitutions of cytosine by thymine in positions 262 and 452, were found only in k-20087, k-20523, k-20524 and k-28126. These accessions belong to different botanical varieties and differ from each other in a number of morphological features, i.e. they are not duplicates. Conclusions. The genotypes selected as a result of the study can serve as a source of the mlo11(cnv2) allele in breeding powdery mildew-resistant barley varieties.



Plant Disease ◽  
2021 ◽  
Author(s):  
Fanfan Wang ◽  
Chunyao Dun ◽  
Tao Tang ◽  
XiaoLiang Guo ◽  
Yuanyuan Duan ◽  
...  

Walnuts are an important perennial nut crop widely cultivated in China, which are rich in protein, carbohydrate, renieratene, and other beneficial nutrients. China is the largest producer of walnuts in the world, with the largest planting area and output. At the end of April 2020, several unknown necrotic spots on leaves of walnut trees were observed in a Juglans regia field located in Sancha Town, Enshi, China (30°28′N, 109°64′E). Initially, lesions were black, small, sunken, and turning to yellowish-brown, irregular, well surrounded by brown margins. Severely, leaf spots coalesced and resulted in withered and abscised. In order to identify the pathogen, infected leaves were collected. Sections of leaves were aseptically excised from the margins of necrotic spots following surface sterilization and placed on potato dextrose agar (PDA) at 28℃. After 4 days, fungal isolates were obtained and purified by hyphal tip isolation. The isolates looked morphologically similar, producing colonies that appeared hyphae with dark grey, lobed margins, and aerial mycelium with white to light gray. After 15 days of incubation, subglobose, dark brown pycnidia (100-176 μm in wide, 75-95 μm in length) were formed with an orifice in the center, producing conidia. Conidia (3.5 to 9.0 × 1.6 to 4.5 μm) were oval to round, aseptate, occasionally 1-septate. These morphological characteristics lead to the conclusion that the isolates may be identified as Phoma sp. (Boerema et al. 1976). A single isolate was randomly selected and designated for further verification. To confirm the identity, the internal transcribed spacer region (ITS), actin (ACT) and beta-tubulin genes were amplified and sequenced ITS1/ITS4, ACT-512F/ACT-783R, and Bt2a/Bt2b, respectively (White et al. 1990, Groenewald et al. 2013). BLAST analysis of the ITS 505-bp sequence (GenBank accession no. MW282913), actin 269-bp sequence (GenBank accession no. MW201958), and beta-tubulin 347-bp sequence (GenBank accession no. MW273782) showed ≥99% homology with the sequences of B. exigua available in GenBank (GenBank accession no. AB454232, LT158234, and KR010463, respectively). Base on the above results, the strain HTY2 was identified as B. exigua. Pathogenicity was tested. Walnut plants were spray-inoculated with a spore suspension (5 x 105 CFU/mL). Controls were inoculated as described above except that sterile distilled water in the dark at 25 ℃. After seven days, lesions were evident at inoculation points, and equivalent to those observed in field were observed. Control leaves remained symptomless. The pathogenicity test was repeated thrice and the results were the same, fulfilling the Koch’s postulates. The pathogen has been reported on various plants around the world, causing a series of symptoms. Infected plants rarely died, but the presence of lesions decreased their fruit quality and yield. Previous identification of the disease is essential in formulating management strategies.



2021 ◽  
Author(s):  
◽  
Daphne Geraldine Carvalho

<p>Net blotch is caused by Pyrenophora teres Drechs. (stat. conid. Drechslera teres (Sacc.) Shoem., syn. Helminthosporium teres Sacc). P. teres produces symptoms which appear initially as small necrotic spots and streaks on the leaf. These increase to produce the characteristic net-like symptoms, which have given rise to the name net blotch. Sometimes, lesions develop from small necrotic spots, to form elliptical lesions. This is the "spot" type of P. teres and was first noticed in 1967 in isolates from North America, Mexico, Israel and Holland. It was thought that these isolates were mutants of P. teres. Since 1969 however, other workers have reported similar observations widely occurring in Norway, Denmark and Finland. Based on minor morphological differences, Ito and Kuribayashi proposed a new species, called P. japonica. Smedegård-Petersen disagreed, and showed that the spot-producing isolate represents a deviating type of P. teres, only differing from the usual "net" type in the symptoms induced on barley plants. He based his reasoning on morphological, cultural and genetical investigations. Consequently, Smedegård-Petersen described two new forms of the fungus, Pyrenophora teres Drechs. f. teres Smedeg., which produces the usual net lesions, and Pyrenophora teres Drechs. f. maculata Smedeg., which produces well defined dark brown circular or elliptical lesions without netting. The aim of the research undertaken in the present study was to conduct a comparative study on the morphology and fitness of a range of New Zealand "net" and "spot" type isolates. An attempt was also made at crossing a "net" type with a "spot" type. Although Smedegård-Petersen had stated that there was no morphological difference between the "net" and "spot" types, this project was undertaken because no research had been done on New Zealand isolates. Furthermore, different features were studied using different methods not used by other workers in studying P. teres. The only morphological difference that was distinctive was that the "spot" types of P. teres formed coremial strands, which were fan-like in morphology, which produced conidia in culture, and the "net" types did not. There was no way to tell the "net" isolates apart from the "spot" isolates, based on conidia colour, length, width, volume or the number of cells per conidium. One fact that did emerge, was that the longest conidia had the greatest number of cells per conidium and the reverse was also true. The germination of monoconidial isolates showed that there were no major differences in branching between the two types of P. teres. However, it was revealed that two germ tubes were capable of emerging from one cell in the "spot" isolates. All cells in a conidium in both the "net" and "spot" types were able to germinate, cells that germinated tended to be at opposite ends, and the first cell to germinate in a conidium was usually the cell at the hilum. Examination of the growth rates showed that there were no significant differences in the growth rates of the "net" and "spot" types when grown on MEA+B. The "spot" types were able to penetrate cellulose faster than the "net" types and hence may produce cellulose faster as well. ANT148, which had previously been an unknown type, was proved to be a "spot" type in the pathogenicity tests. It may have been the source of the New Zealand "spot" type inoculum because the seed it came from was imported into New Zealand in 1984, two years prior to the discovery of the "spot" type of P. teres in the South Island. Both forms of P. teres penetrated the leaf through the epidermal cell wall, and occasionally entered through the stomata. Even though the "spot" type may be present inside the leaf, the symptoms are not usually manifested until later, compared with the "net" type where the symptoms tend to be an indication of the amount of hyphae present in the leaf. In the screening of the progeny from the crossing, the "spot" type of P. teres had lost up to 78.9% of its resistance to triadimenol and flutriafol, when compared to the sensitivity tests carried out in 1986 and 1987. It is hypothesised that 13Y, the "net" type is dominant, and the "spot" type, KF2, recessive, as none of the progeny had any resistance to triadimenol or flutriafol, after undergoing somatic recombination. It was concluded that the "spot" and "net" types are two types of the same species, and there was not enough evidence to suggest otherwise. Further studies should be done, using more current isolates of the "net" and "spot" types of P. teres, and the old D. japonica isolates from New Zealand, to establish if the cultures identified as D. japonica, are different in any way.</p>



2021 ◽  
Author(s):  
◽  
Daphne Geraldine Carvalho

<p>Net blotch is caused by Pyrenophora teres Drechs. (stat. conid. Drechslera teres (Sacc.) Shoem., syn. Helminthosporium teres Sacc). P. teres produces symptoms which appear initially as small necrotic spots and streaks on the leaf. These increase to produce the characteristic net-like symptoms, which have given rise to the name net blotch. Sometimes, lesions develop from small necrotic spots, to form elliptical lesions. This is the "spot" type of P. teres and was first noticed in 1967 in isolates from North America, Mexico, Israel and Holland. It was thought that these isolates were mutants of P. teres. Since 1969 however, other workers have reported similar observations widely occurring in Norway, Denmark and Finland. Based on minor morphological differences, Ito and Kuribayashi proposed a new species, called P. japonica. Smedegård-Petersen disagreed, and showed that the spot-producing isolate represents a deviating type of P. teres, only differing from the usual "net" type in the symptoms induced on barley plants. He based his reasoning on morphological, cultural and genetical investigations. Consequently, Smedegård-Petersen described two new forms of the fungus, Pyrenophora teres Drechs. f. teres Smedeg., which produces the usual net lesions, and Pyrenophora teres Drechs. f. maculata Smedeg., which produces well defined dark brown circular or elliptical lesions without netting. The aim of the research undertaken in the present study was to conduct a comparative study on the morphology and fitness of a range of New Zealand "net" and "spot" type isolates. An attempt was also made at crossing a "net" type with a "spot" type. Although Smedegård-Petersen had stated that there was no morphological difference between the "net" and "spot" types, this project was undertaken because no research had been done on New Zealand isolates. Furthermore, different features were studied using different methods not used by other workers in studying P. teres. The only morphological difference that was distinctive was that the "spot" types of P. teres formed coremial strands, which were fan-like in morphology, which produced conidia in culture, and the "net" types did not. There was no way to tell the "net" isolates apart from the "spot" isolates, based on conidia colour, length, width, volume or the number of cells per conidium. One fact that did emerge, was that the longest conidia had the greatest number of cells per conidium and the reverse was also true. The germination of monoconidial isolates showed that there were no major differences in branching between the two types of P. teres. However, it was revealed that two germ tubes were capable of emerging from one cell in the "spot" isolates. All cells in a conidium in both the "net" and "spot" types were able to germinate, cells that germinated tended to be at opposite ends, and the first cell to germinate in a conidium was usually the cell at the hilum. Examination of the growth rates showed that there were no significant differences in the growth rates of the "net" and "spot" types when grown on MEA+B. The "spot" types were able to penetrate cellulose faster than the "net" types and hence may produce cellulose faster as well. ANT148, which had previously been an unknown type, was proved to be a "spot" type in the pathogenicity tests. It may have been the source of the New Zealand "spot" type inoculum because the seed it came from was imported into New Zealand in 1984, two years prior to the discovery of the "spot" type of P. teres in the South Island. Both forms of P. teres penetrated the leaf through the epidermal cell wall, and occasionally entered through the stomata. Even though the "spot" type may be present inside the leaf, the symptoms are not usually manifested until later, compared with the "net" type where the symptoms tend to be an indication of the amount of hyphae present in the leaf. In the screening of the progeny from the crossing, the "spot" type of P. teres had lost up to 78.9% of its resistance to triadimenol and flutriafol, when compared to the sensitivity tests carried out in 1986 and 1987. It is hypothesised that 13Y, the "net" type is dominant, and the "spot" type, KF2, recessive, as none of the progeny had any resistance to triadimenol or flutriafol, after undergoing somatic recombination. It was concluded that the "spot" and "net" types are two types of the same species, and there was not enough evidence to suggest otherwise. Further studies should be done, using more current isolates of the "net" and "spot" types of P. teres, and the old D. japonica isolates from New Zealand, to establish if the cultures identified as D. japonica, are different in any way.</p>



Plant Disease ◽  
2021 ◽  
Author(s):  
Yen-Chieh Wang ◽  
Jan-Hong Liu ◽  
Chieh-Chen Huang ◽  
Cheng-Fang Hong

Dragon fruit (Hylocereus polyrhizus & H. undatus) is a rapidly growing commodity in Taiwan. The production acreage has been tripled since 2011, with an estimation of over 2,800 ha in 2019. From disease survey conducted in July 2020, reddish orange to blackish brown lesions similar to stem canker caused by Neoscytalidium dimidiatum on dragon fruit cladodes (Supplementary Fig. S1, Q) were observed from two orchards in Central Taiwan. Diseased cladodes were brought back to the lab, surface disinfested with 70% ethanol for 15 to 30 sec, and then blotted dried with a paper towel. Small pieces (about 3x3 mm) of necrotic spots were excised, placed on 2% water agar (WA) plates, and incubated with 12 h photoperiod at 28 ± 2 ℃ for 3 days. Among the necrotic spots that were used for fungal isolation, some were detected to have N. dimidiatum accounting for 21 isolates, while three isolates detected in other spots were unknown. Single hyphal tips of the three unknown fungal colonies with similar morphology were transferred on potato dextrose agar (PDA). Brownish- to grayish-white colonies with fluffy aerial mycelium were observed on PDA (Supplementary Fig. S1, A, B, E, F, I and J) after 8 days of incubation. To induce the sporulation, all the fungal isolates were cultivated on autoclaved cowpea pods on 2% WA plates with 12 h photoperiod at 25 ± 2 ℃ for 3 weeks. Black pycnidia embedded in cowpea tissues and creamy yellowish exudates with pycnidiospores extruding from the ostiole were observed (Supplementary Fig. S1, C, G and K). Alpha-conidia were characterized as aseptate, hyaline, smooth, ellipsoidal or fusiform, often bi-guttulate and measured about 6.0 to 6.5 μm × 2.0 to 2.3 μm (n = 50 for each isolate) (Supplementary Fig. S1, D, H and L). Beta-conidia were not observed. Morphological characteristics of these isolates were similar to Diaporthe spp. described by Udayanga et al. (2015). To further identify the fungal isolates, the internal transcribed spacer (ITS), β-tubulin (TUB) and translation elongation factor 1-α (EF1-α) regions were amplified using primer pairs ITS1/ITS4 (White et al. 1990), Bt2a/Bt2b (Glass & Donaldson 1995) and EF1-728F/EF1-986R (Carbone & Kohn 1999), respectively. BLAST analysis of isolates CH0720-010 (ITS: OK067377; TUB: OK149767; EF1-α: OK149764), CH0720-013 (ITS: OK067378; TUB: OK149768; EF1-α: OK149765) and TC0720-016 (ITS: OK067379; TUB: OK149769; EF1-α: OK149766) showed 99.78 to 100% of ITS identity, 98.8 to 99.2% of TUB identity, and 100% of EF1-α identity with Diaporthe ueckerae (ITS: KY565426; TUB: KY569384; EF1-α: KY569388). Phylogenetic trees were constructed using concatenated ITS, TUB, and EF1-α sequences based on maximum likelihood with HKY+G model, maximum parsimony, and Bayesian inference method in MEGA X and Geneious Prime 2020.2.4. All isolates were clustered in D. ueckerae with similar topology based on aforementioned methods, hence the phylogram of maximum likelihood was presented (Supplementary Fig. S2). To confirm the pathogenicity, detached dragon fruit (H. polyrhizus and H. undatus) cladodes (20 to 30 cm in length) were surface disinfested, wounded with sterilized syringe (about 2 mm in depth), and inoculated with mycelial plugs (6 mm in diam.) from 5-day-old colonies on PDA. Each isolate had three mycelial plugs and the PDA plugs without mycelium were inoculated as negative control. Inoculated cladodes were placed in a moisture chamber and incubated at 30 ± 2 ℃ with 12 h photoperiod. Two days after inoculation (DAI), the agar plugs were removed and symptom development on the cladodes was photo recorded every other day. The inoculation experiment was repeated twice. At 6 DAI, round to irregular, dark-brown, and water-soaking lesions were observed on the cladodes of both species inoculated with the three D. ueckerae isolates whereas all negative controls remained asymptomatic (Supplementary Fig. S1, M-P). Morphologically identical fungi were re-isolated from inoculated cladodes, fulfilling Koch’s postulates. Several Diaporthe species have been reported infecting dragon fruit in the southeastern Asian countries such as Thailand, Bangladesh and Malaysia (Udayanga et al. 2012; Karim et al. 2019; Huda-Shakirah et al. 2021). To our knowledge, this is the first report of stem rot caused by D. ueckerae in Taiwan. Since the field symptoms may be easily confused with those caused by N. dimidiatum, the potential threat of Diaporthe species complex on dragon fruit should be aware and may warrant further study.



2021 ◽  
Vol 20 (5) ◽  
pp. 97-106
Author(s):  
Beata Zimowska ◽  
Ewa Dorota Król

Anthracnose, caused by Colletotrichum fuscum, produces regular necrotic spots on oregano leaves and stems, causing severe crop losses. In this study, Koch’s postulates were fulfilled and infection process was investigated using scanning electron microscopy. Leaves and stems of Origanum vulgare were inoculated and incubated at 24°C in wet chambers under high relative humidity. Pathogenicity experiments demonstrated that all tested C. fuscum isolates had infected stems and leaves of oregano. Of all inoculation methods, direct placement of colonized agar plugs on injured epidermis and soaking plant organs in conidial suspension were the most effective. The behavior of the conidia deposited on the oregano leaves was investigated at different time intervals after inoculation: at 12, 18, 32, 48, 67 and 98 h. Conidia produced an appressoria of varying shapes which has been formed at the end of germ tubes of different lengths. Penetration to host tissue through stomata was observed. Acervuli formed on the leaves surface after 98 h after inoculation, typically with sharp pointed setoses.



2021 ◽  
Vol 875 (1) ◽  
pp. 012050
Author(s):  
V Tsaralunga ◽  
A Tsaralunga ◽  
N Yakovenko ◽  
Yu Gridnev

Abstract The article assesses the impact of the intensity of selective sanitary cutting in oak forests on the defeat of oak trees by powdery mildew. The research methodology included visual estimation and detailed inspection of oak plantations. On their basis, the species composition of pathogens was identified, the degree of crown desiccation from a complex of factors and leaf infestation with powdery mildew and necrotic spots was assessed. The dispersive analysis was applied for data processing. The analysis of the long-term survey of the plots passed by selective sanitary cutting shows that the degree of damage to oak trees by powdery mildew on permanent test areas practically does not depend directly from selective sanitary cutting, in general, and from their intensity, in particular. The dynamics of the damage degree of the oak trees by powdery mildew changed almost synchronously in all test areas and in the control area. The results can be used in the practice of the Voronezh region forestry enterprises when carrying out forest pathology surveys.



Author(s):  
S.V. Zelentsov ◽  
◽  
G.М. Saenko ◽  
E.V. Moshnenko ◽  
E.N. Budnikov ◽  
...  

One of the significant reasons for the decrease in the sowing quality of seeds in leguminous crops all over the world is bacterial blight of seeds in the form of necrotic decaying spots on the outer or inner side of the cotyledons. A hypothesis was put forward about the presence of a common primary non-bacterial cause of the development of necrosis on cotyledons, regardless of the species, variety and growing zone. The studies were carried out in 2016– 2020 in V.S. Pustovoit All-Russian Research Institute of Oil Crops, Krasnodar, on seeds of soybeans, common bean, chickpea, white and narrow-leaved lupines. On immature seeds of healthy soybean plants in the phases of full filling and the beginning of physiological maturation, bacterial blight of seeds are never observed. Secondary (rain) moistening of mature seeds leads to the development of cotyledon necrosis and a decrease in their germination in soybeans, common beans, chickpeas, white lupine and narrow-leaved lupine. The physiological reason for the formation of cotyledon necrosis during the secondary moistening of mature seeds is the death of the tissues of the cotyledons, moistened before the stage of nucleic acid synthesis, and unable to return to the dormant stage upon repeated drying. Symptoms of the development of cotyledon necrosis after secondary moistening of mature seeds, and bacterial blight of seeds, are practically identical in all leguminous crops. The common primary cause of the formation of necrotic spots on the surface of the cotyledons, identified as bacterial blight of seeds, regardless of the species of legumes, variety and ecological-geographical zone of cultivation, is the secondary (rain) moisture of seeds that have not yet been harvested in the field of mature plants. Isolation of bacterial pathogens of various species and families in necrotic areas of the cotyledons can be explained by secondary infection of already dead tissues. Therefore, the species composition of bacterial microflora in each case will be determined by its presence in the environment.



Plant Disease ◽  
2021 ◽  
Author(s):  
Hector Garcia ◽  
Elisa Miranda ◽  
Miguel Abelardo López ◽  
Samuel Parra ◽  
Carlos Rubilar ◽  
...  

Chile is the main exporter of sweet cherries (Prunus avium), with a total of 228.6 thousand tons exported in the 2019-20 season, and a production from the Coquimbo to the Aysén region (http://www.iqonsulting.com/yb/). In January 2019, cherry trees from a commercial orchard located near Osorno city (40°37'S, 72°54'W), Region de Los Lagos, Chile, showed symptoms such as the presence of wood cankers, necrotic spots in leaves, and premature defoliation, with a mean disease incidence near 40%. Symptomatic leaves with necrotic spots were collected for analysis, from which all the necrotic spots were extracted by incision with a sterile scalpel, macerated in 30 mL of AFT buffer and subsequently, 100 µL of the suspension was plated on King’s B (KB) agar and incubated for 48 to 72 h at 27°C, obtaining a total of two bacterial colonies identified as 7684.1 and 7684.2. Afterward, each colony was stroked in a new KB agar plate, incubated for 16 h at 27°C, and the obtained biomass was used in subsequent experiments. In KB agar, both colonies exhibited fluorescence under UV light and, according to the LOPAT method (Lelliott et al., 1966), they were gram negative, positive to levan and tobacco hypersensitivity tests and negative to oxidase, potato soft rot, arginine dihydrolase and gelatin tests, and were confirmed as Pseudomonas syringae. Then, the 16s and gyrB genes of each isolate were amplified by PCR, sequenced, and compared with the NCBI Genbank database (Weisburg et al., 1991; Sarkar and Guttman, 2004), finding a 99,93% genetic similarity (1064/1065) with a previously reported 16s sequence of a Pseudomonas syringae pv. morsprunorum (Psm) isolate (accession number CP026558.1), and a 99,69% (636/638) with a previously reported gyrB gene of Psm (accession number LC364094.1), respectively. Additionally, the closest pathovar different to morsprunorum aligned with our gyrB sequence was P. syringae pv. aesculin, with 97,8% of identity (624/638). Our sequences were deposited in Genbank with the accession numbers MN528473 (16s), MN535696 (gyrB) for 7684.1, and MN528474 (16s), MN535697 (gyrB) for 7684.2. To identify if the isolates correspond to Psm races 1 (Psm1) or 2 (Psm2), race-specific conventional PCRs and qPCRs assays were carried out using the specific primers described by Kaluzna et al., (2016), showing that the two isolates were positive to Psm1 in both PCR assays. Pathogenicity was tested by inoculating immature cherry fruitlets (cv. Sweetheart) with bacterial suspension at 108 CFU/mL. For each strain, ten fruitlets were inoculated by pricking with a sterile needle previously immersed in the bacterial suspension (Ruinelli et al., 2019). Sterile distilled water was used as negative control. Seven to fourteen days post-inoculation, necrotic and water-soaked brown lesions with yellow margins were observed on the fruits inoculated with bacterial strains. The pathogen was reisolated and confirmed as Pseudomonas syringae pv. morsprunorum by 16s and gyrB sequencing, and as race 1 by race-specific PCRs. Our results were confirmed by the National Plant Protection Organization, (Servicio Agrícola y Ganadero de Chile, SAG), generating the first report of Psm race 1 in Chile. Thus, SAG established new protocols for quarantine of absent pests in the national territory (Resol. N°3080, SAG, Chile), and an immediate phytosanitary program for Psm (Resol. Exenta N°8948/2019, SAG, Chile). In conclusion, our discovery contributes to the monitoring and control of the disease in Chile.



Plant Disease ◽  
2021 ◽  
Author(s):  
Shusen Liu ◽  
Ning Guo ◽  
HongXia Ma ◽  
Hua Sun ◽  
Xiaojuan Zheng ◽  
...  

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch’s postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.



Sign in / Sign up

Export Citation Format

Share Document